معلومة

3 بادئات لمعرفة ما إذا كانت متماثلة اللواقح أو متغايرة الزيجوت أو WT

3 بادئات لمعرفة ما إذا كانت متماثلة اللواقح أو متغايرة الزيجوت أو WT



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

في هذه التجربة الخيالية ، أستخدم T-DNA لعمل طفرة إدخال يتم إدخالها عشوائيًا في الحمض النووي حيث يمكن إدخالها داخل الجين ، مما يؤدي إلى تعطيله.

من أجل الحصول على أفراد متماثلة اللواقح ، إذا كنت أعمل على النباتات ، يمكنني تلقيح هذا النبات المعين الذي تسبب في خلل في هذا الجين ليصنع ذرية متماثلة اللواقح.

لإثبات ذلك ، يمكنني إجراء اختبار تفاعل البوليميراز المتسلسل باستخدام 3 بادئات.

سؤالي هو ، لماذا 3 برايمر؟ سأستخدم 4 برايمر! لقد كنت أبحث عنه وأحاول أن أفهمه بنفسي منذ فترة ، لكني لم أصل إلى أي نتيجة إيجابية. أعتقد أنه يجب أن يكون أساسيًا جدًا وأنا أفتقد شيئًا ما.

أعتقد أنني بحاجة إلى بادئات أمامية وعكسية لـ T-DNA ، لكن ماذا عن التمهيدي الثالث؟ إذا استخدمت هذين البادئين فقط ، فلن أكون قادرًا على التمييز بين متماثل الزيجوت ومتغاير الزيجوت.

شكرا!


الضربة القاضية الجينية

أ الضربة القاضية الجينية (اختصار: KO) هي تقنية وراثية يتم فيها جعل أحد جينات الكائن الحي معطلاً ("يُطرح" من الكائن الحي). ومع ذلك ، يمكن أن يشير KO أيضًا إلى الجين الذي تم القضاء عليه أو الكائن الحي الذي يحمل الجين بالضربة القاضية. كائنات الضربة القاضية أو ببساطة بالضربة القاضية تستخدم لدراسة وظيفة الجينات ، عادة عن طريق التحقيق في تأثير فقدان الجين. يستخلص الباحثون استنتاجات من الاختلاف بين الكائن الحي الضرب والأفراد العاديين.

إن تقنية KO هي في الأساس نقيض الضربة الجينية. يُعرف التخلص من جينين في وقت واحد في الكائن الحي باسم a الضربة القاضية المزدوجة (DKO). وبالمثل الشروط الثلاثي بالضربة القاضية (TKO) و الضربات القاضية الرباعية (QKO) لوصف ثلاثة أو أربعة جينات مقطوعة ، على التوالي. ومع ذلك ، يحتاج المرء إلى التمييز بين KOs متغايرة الزيجوت ومتماثلة اللواقح. في السابق ، يتم التخلص من نسخة واحدة فقط من نسختين من الجينات (الأليلات) ، وفي الثانية يتم التخلص من كلا النسختين.


تحليل متغاير الزيجوت الشرطي STXBP1 الطفرات في الخلايا العصبية البشرية

3 معهد هوارد هيوز الطبي ، كلية الطب بجامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية.

عنوان المراسلات إلى: كريستوفر باتزكي ، كلية الطب بجامعة ستانفورد ، 265 Campus Drive ، ستانفورد ، كاليفورنيا 94305 ، الولايات المتحدة الأمريكية. الهاتف: 650.724.5264 البريد الإلكتروني: [email protected]

ملاحظة التأليف: ساهم كريستوفر باتزكي ويان هان بالتساوي في هذا العمل.

1 قسم الفسيولوجيا الجزيئية والخلوية ،

2 معهد بيولوجيا الخلايا الجذعية والطب التجديدي وقسم علم الأمراض ، و

3 معهد هوارد هيوز الطبي ، كلية الطب بجامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية.

عنوان المراسلات إلى: كريستوفر باتزكي ، كلية الطب بجامعة ستانفورد ، 265 Campus Drive ، ستانفورد ، كاليفورنيا 94305 ، الولايات المتحدة الأمريكية. الهاتف: 650.724.5264 البريد الإلكتروني: [email protected]

ملاحظة التأليف: ساهم كريستوفر باتزكي ويان هان بالتساوي في هذا العمل.

1 قسم الفسيولوجيا الجزيئية والخلوية ،

2 معهد بيولوجيا الخلايا الجذعية والطب التجديدي وقسم علم الأمراض ، و

3 معهد هوارد هيوز الطبي ، كلية الطب بجامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية.

عنوان المراسلات إلى: كريستوفر باتزكي ، كلية الطب بجامعة ستانفورد ، 265 Campus Drive ، ستانفورد ، كاليفورنيا 94305 ، الولايات المتحدة الأمريكية. الهاتف: 650.724.5264 البريد الإلكتروني: [email protected]

ملاحظة التأليف: ساهم كريستوفر باتزكي ويان هان بالتساوي في هذا العمل.

1 قسم الفسيولوجيا الجزيئية والخلوية ،

2 معهد بيولوجيا الخلايا الجذعية والطب التجديدي وقسم علم الأمراض ، و

3 معهد هوارد هيوز الطبي ، كلية الطب بجامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية.

عنوان المراسلات إلى: كريستوفر باتزكي ، كلية الطب بجامعة ستانفورد ، 265 Campus Drive ، ستانفورد ، كاليفورنيا 94305 ، الولايات المتحدة الأمريكية. الهاتف: 650.724.5264 البريد الإلكتروني: [email protected]

ملاحظة التأليف: ساهم كريستوفر باتزكي ويان هان بالتساوي في هذا العمل.

1 قسم الفسيولوجيا الجزيئية والخلوية ،

2 معهد بيولوجيا الخلايا الجذعية والطب التجديدي وقسم علم الأمراض ، و

3 معهد هوارد هيوز الطبي ، كلية الطب بجامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية.

عنوان المراسلات إلى: كريستوفر باتزكي ، كلية الطب بجامعة ستانفورد ، 265 Campus Drive ، ستانفورد ، كاليفورنيا 94305 ، الولايات المتحدة الأمريكية. الهاتف: 650.724.5264 البريد الإلكتروني: [email protected]

ملاحظة التأليف: ساهم كريستوفر باتزكي ويان هان بالتساوي في هذا العمل.

اعثر على مقالات بواسطة Maxeiner، S. في: JCI | PubMed | منحة جوجل

1 قسم الفسيولوجيا الجزيئية والخلوية ،

2 معهد بيولوجيا الخلايا الجذعية والطب التجديدي وقسم علم الأمراض ، و

3 معهد هوارد هيوز الطبي ، كلية الطب بجامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية.

عنوان المراسلات إلى: كريستوفر باتزكي ، كلية الطب بجامعة ستانفورد ، 265 Campus Drive ، ستانفورد ، كاليفورنيا 94305 ، الولايات المتحدة الأمريكية. الهاتف: 650.724.5264 البريد الإلكتروني: [email protected]

ملاحظة التأليف: ساهم كريستوفر باتزكي ويان هان بالتساوي في هذا العمل.

1 قسم الفسيولوجيا الجزيئية والخلوية ،

2 معهد بيولوجيا الخلايا الجذعية والطب التجديدي وقسم علم الأمراض ، و

3 معهد هوارد هيوز الطبي ، كلية الطب بجامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية.

عنوان المراسلات إلى: كريستوفر باتزكي ، كلية الطب بجامعة ستانفورد ، 265 Campus Drive ، ستانفورد ، كاليفورنيا 94305 ، الولايات المتحدة الأمريكية. الهاتف: 650.724.5264 البريد الإلكتروني: [email protected]

ملاحظة التأليف: ساهم كريستوفر باتزكي ويان هان بالتساوي في هذا العمل.

طفرات متغايرة الزيجوت في البروتين المرتبط بالسينتاكسين 1 (STXBP1) الجين ، الذي يشفر Munc18-1 ، وهو مكون أساسي لآلة اندماج الغشاء قبل المشبكي ، يسبب اعتلال دماغي صرع مبكر عند الأطفال (متلازمة أوهتهارا) ، لكن من غير الواضح كيف ينتج عن الخسارة الجزئية لـ Munc18-1 هذا العرض السريري الشديد. هنا ، قمنا بتوليد الخلايا الجذعية الجنينية البشرية المصممة للتعبير المشروط عن متغاير الزيجوت ومتماثل الزيجوت STXBP1 طفرات فقدان الوظيفة و WT متساوي المنشأ و STXBP1- الخلايا العصبية البشرية الطافرة المشتقة من هذه الخلايا الجذعية الجنينية الطافرة مشروطًا. أظهرنا أن متغاير الزيجوت STXBP1 تخفض الطفرات مستويات بروتين Munc18-1 وشريكه الملزم ، بروتين t-SNARE-Syntaxin-1 ، بحوالي 30٪ ويقلل إطلاق الناقل العصبي العفوي والمستثار بحوالي 50٪. وهكذا ، تؤكد نتائجنا أن استخدام الخلايا الجذعية الجنينية البشرية (ES) هو نهج قابل للتطبيق لدراسة الطفرات المرتبطة بالأمراض في الخلايا العصبية البشرية على خلفية وراثية خاضعة للرقابة ، مما يدل على أن جزئيًا STXBP1 يضعف فقدان الوظيفة بقوة إطلاق الناقل العصبي في الخلايا العصبية البشرية ، ويوحي بأن متغاير الزيجوت STXBP1 الطفرات تسبب اعتلال دماغي صرع مبكر على وجه التحديد من خلال ضعف ما قبل المشبكي.

حددت التطورات الحديثة في علم الوراثة البشرية مئات الطفرات غير المتجانسة التي قد تسبب اضطرابات النمو العصبي مثل التخلف العقلي أو التوحد أو الفصام (1-5). يثير تحديد هذه الطفرات سؤالين رئيسيين: هل طفرة معينة مسببة للأمراض حقًا ، أم أنها تمثل تعدد الأشكال؟ إذا كانت الطفرة مسببة للأمراض ، فكيف تسبب ضعفًا يؤدي إلى المرض؟ يتمثل النهج التقليدي لمعالجة هذه الأسئلة في دراسة الخلايا العصبية المتمايزة عن الخلايا الجذعية المحفزة بالمريض (iPS) مقارنة بالخلايا العصبية المشتقة من خلايا iPS للتحكم لتحديد التشوهات المحتملة (6 - 17). على الرغم من قوته ، إلا أن هذا النهج لا يكشف بالضرورة عما إذا كانت الطفرة تنتج نمطًا ظاهريًا معينًا لأن الخلايا العصبية الخاضعة للاختبار والتحكم التي تم تحليلها تحمل خلفيات وراثية مختلفة ومشتقة من استنساخ خلايا iPS متميزة (18 ، 19). من المحتمل أن تكون الخلفيات الجينية مهمة ، لأن العديد من الطفرات المرتبطة بالأمراض يمكن أن تنتج سريريًا أنماطًا ظاهرية مميزة.

مئات الطفرات متغايرة الزيجوت في البروتين المرتبط بالسينتاكسين 1 (STXBP1) الجين في المرضى الذين يعانون من أشكال حادة من اعتلال الدماغ الصرع المبكر (يشار إليها باسم Ohtahara أو متلازمة الغرب المرجع 20-22) وغيرها من العروض السريرية الشديدة عادة (23 - 25). ومع ذلك ، فمن غير المعروف كيف STXBP1 تؤثر الطفرات والفقدان الجزئي لـ Munc18-1 على الوظيفة العصبية للإنسان ، سواء كانت هذه الطفرات تنتج المرض عن طريق التسبب في ضعف غير عصبي ، وما إذا كانت التغييرات التي تنتج عن STXBP1 من المحتمل أن تكون الطفرات قابلة للعلاج (26 ، 27).

من أجل معالجة هذه الأسئلة ، نحتاج إلى نهج يسمح لنا باختبار كيفية فقدان وظيفة متغايرة الزيجوت STXBP1 يؤثر بشكل خاص على الخصائص العصبية البشرية في الخلايا ذات الخلفية الوراثية الخاضعة للرقابة. تحقيقا لهذه الغاية ، استخدمنا إعادة التركيب المتماثل لطفرات STXBP1 ترميز الجين Munc18-1 في الخلايا الجذعية الجنينية البشرية H1 (الشكل 1A). أصيبت الخلايا الجذعية الجنينية (التي لا تعبر عن Munc18-1) بفيروس مرتبط بالغدة مؤتلف (AAV) يحتوي على WT البشري. STXBP1 تسلسل من منطقة ترميز exon 2. في AAV ، كان exon 2 محاطًا بمواقع loxP (لحذف exon بواسطة Cre-recombinase) ، وكاسيت مقاومة اختيار الدواء المحاط بمواقع frt (للحذف بواسطة Flp-recombinase ) بالإضافة إلى ذلك المجاورة لموقع 5 ′ loxP (الشكل 1A). تم إنتاج AAVs مع اثنين من علامات المقاومة المختلفة للسماح بتوليد خلايا KO (cKO) الشرطية متجانسة ومتجانسة. تم عزل العديد من الحيوانات المستنسخة المقاومة للأدوية وفحصها بواسطة تفاعل البوليميراز المتسلسل. تم اختيار نسختين مستنسختين من الخلايا ES غير المتجانسة والمتجانسة للتحليلات (الشكل 1B والشكل التكميلي 1 ، A و C المواد التكميلية المتاحة عبر الإنترنت مع هذه المقالة doi: 10.1172 / JCI78612DS1). تم تصميم نهج cKO هذا للسماح بتحليل آثار الطفرات غير المتجانسة والمتماثلة اللواقح في الخلايا البشرية على خلفية وراثية محكومة ، وبالتالي القضاء على التأثيرات المربكة المحتملة الناجمة عن تغييرات الخلفية الجينية أو اختيار الخلايا المستنسخة (28).

الهندسة الوراثية الشرطية STXBP1 الطفرات الجينية في الخلايا الجذعية الجنينية البشرية وتوليد خلايا iN من الخلايا الجذعية الجنينية الطافرة المشروط. (أ) استراتيجية الاستهداف. ال STXBP1 تم تحور الجين عن طريق إعادة التركيب المتماثل في خلايا H1 ES باستخدام AAVs التي تحتوي على التسلسلات المشار إليها. تم تأكيد الحيوانات المستنسخة المقاومة للأدوية بواسطة PCR باستخدام البادئات رقم. من 1 إلى لا. 3. مثال 2 ، إكسون 2 بيضاوي أحمر ، مواقع loxP مثلثات زرقاء ، مواقع frt. (بتحليل تفاعل البوليميراز المتسلسل (PCR) لخلايا WT ES و 2 من استنساخ خلايا ES غير متجانسة ومتماثلة اللواقح. تم إجراء PCRs باستخدام الاشعال المشار إليه (انظر أ). في هذه اللوحة ، Munc18-1 + / + يشير إلى الخلايا الجذعية الجنينية غير المستهدفة. (ج) تصميم نواقل الفيروسة البطيئة للتمايز السريع الموجه بوساطة Ngn2 للخلايا الجذعية الجنينية في خلايا iN. (د) مخطط تدفق تجارب خلايا iN. تم إصابة الخلايا الجذعية الجنينية الطافرة المشروط في اليوم الأول بالفيروسات البطيئة المستخدمة في توليد خلايا iN (كما هو موضح في ج) بالإضافة إلى الفيروس البطيء الذي يعبر إما عن Flp-recombinase (الذي يزيل شريط المقاومة ويعيد تنشيطه STXBP1 التعبير ، مما أدى إلى Munc18-1 + / + الخلايا العصبية) أو Cre-recombinase (الذي يحذف exon 2 من STXBP1 الجين ، مما أدى إلى Munc18-1 - / + أو Munc18-1 - / - الخلايا العصبية). (ه) صور مضان تمثيلية للتحكم وخلايا iN المتحولة المشتقة من متغاير الزيجوت (أعلى) أو متماثل الزيجوت بشروط STXBP1- الخلايا الجذعية الجنينية الطافرة (أسفل). تم إصابة الخلايا الجذعية الجنينية بالعدوى في يوم تحريض خلية iN مع الفيروس البطيء المعبر عن EGFP لتصور صور الخلايا العصبية في اليوم 23. شريط المقياس: 200 ميكرومتر. للحصول على بيانات إضافية حول اختيار الخلايا العصبية والمزيد من الصور التمثيلية ، انظر الشكل التكميلي 1.

لتحليل النتائج المظهرية لـ STXBP1 طفرات فقدان الوظيفة ، استخدمنا نهج الخلايا العصبية المستحثة (خلية iN) التي يتم فيها إنتاج الخلايا العصبية من خلايا ES أو خلايا iPS عن طريق التعبير القسري لعوامل النسخ (29 ، 30). اختبرنا أولاً ما إذا كان متغاير الزيجوت ومتماثل الزيجوت STXBP1- يمكن تحويل الخلايا الجذعية الجنينية الطافرة بكفاءة إلى خلايا عصبية لخلايا iN بالتعبير عن عامل النسخ Neurogenin-2 (Ngn2) باستخدام تباين في بروتوكولنا القياسي الموصوف سابقًا (الشكل 1 و C و D والمرجع 29). لقد أصابنا الخلايا الجذعية الجنينية في اليوم الأول بالفيروسات التي تعبر عن Ngn2 والمعاملات العكسية التي يتحكم فيها التتراسيكلين (rtTA) (التي تدفع التمايز الموجه للخلايا الجذعية الجنينية إلى الخلايا العصبية من خلال الإجراء القياسي ، المرجع 29) بالإضافة إلى الفيروسات التي تعبر عن إما Flp-recombinase (لإزالة شريط المقاومة وإنشاء ملف نشط STXBP1 allele) أو Cre-recombinase (لإزالة exon 2 وإلغاء تنشيطه STXBP1 التعبير ، لأن حذف exon 2 يخلق كودون توقف سابق لأوانه). نتيجة لذلك ، أنتجنا من نفس المجموعة من الخلايا الجذعية الجنينية المتجانسة من الخلايا العصبية للتحكم في WT (يشار إليها باسم Munc18-1 + / + ) ومتغاير الزيجوت أو متماثل الزيجوت STXBP1- الخلايا العصبية الطافرة (يشار إليها باسم Munc18-1 - / + أو Munc18-1 - / - ، على التوالى). كان إنتاج هذه الخلايا العصبية فعالًا بالمثل مع تعايش إعادة التركيب Flp- أو Cre-recombinases. ومع ذلك ، لاحظنا أن متماثل الزيجوت ولكن ليس متغاير الزيجوت STXBP1متحول Munc18-1 - / - بدأت الخلايا العصبية في التدهور بعد أسبوع واحد وأظهرت موت الخلايا العصبية الهائل خلال 3 أسابيع في الثقافة (الشكل 1E والشكل التكميلي 3A انظر التحليل أدناه).

كشف تحليل التجلط المناعي أن متغاير الزيجوت STXBP1أظهرت الخلايا العصبية الطافرة انخفاضًا في مستويات بروتين Munc18-1 ، في حين أن الخلايا متماثلة اللواقح STXBP1تفتقر الخلايا العصبية الطافرة إلى بروتين Munc18-1 ، كما هو متوقع (الشكل 2 أ). القياس الكمي لمستويات بروتين Munc18-1 في خلايا iN المشتقة من 2 متغاير الزيجوت المستقل STXBP1- أظهرت استنساخ الخلايا الجذعية الجنينية الطافرة أن كلاهما كان عرضة لانخفاض مماثل في مستويات Munc18-1 (

30 ٪ ينقص الشكل 2B والشكل التكميلي 1B لمستويات mRNA). كشفت دراسة استقصائية للبروتينات المشبكية الأخرى أن مستويات Syntaxin-1 قد انخفضت أيضًا بشكل انتقائي (الشكل 2B والشكل التكميلي 2 و A و B). لم يُظهر أي بروتين آخر تم فحصه تغيرات في المستويات. تتفق هذه النتائج مع الدراسات التي أجريت على الفئران التي تم فيها قمع مستويات بروتين Syntaxin-1 عندما يتم حذف بروتين Munc18-1 ويتم كبح مستويات البروتين Munc18-1 بالعكس عندما يتم استئصال تعبير Syntaxin-1 (31 - 34) ، مما يشير إلى أن Munc18-1 و Syntaxin-1 يتصرفان مثل الوحدات الفرعية المعتمدة على بعضها البعض في مجمع يعمل على استقرار بعضها البعض.

تكوين البروتين والبقاء على قيد الحياة والتمايز العصبي من STXBP1- الخلايا العصبية البشرية الطافرة. (أ) اللطخات المناعية والبقع الملطخة بالبونسو للتحكم وخلايا iN المتحولة متغايرة الزيجوت والمتماثلة اللواقح. (ب) مستويات البروتين في السيطرة المتطابقة والمستنسخات المستقلة من متغاير الزيجوت STXBP1- خلايا iN الطافرة ، التي تحددها التكتل المناعي الكمي (انظر أيضًا الشكل التكميلي 2 و A و B). *ص & lt 0.05 ، للطالب ر اختبار. (ج) رسم جزء من الخلايا العصبية الباقية مقارنة بعناصر التحكم (الخط المنقط) كدالة لوقت الثقافة. الشروط المختبرة: خلايا متغايرة الزيجوت من خليتين متماثلتين من الخلايا الجذعية الجنينية (حمراء) متماثلة اللواقح تم إنشاؤها مع ظروف قياسية مزروعة بمفردها (خضراء) أو تمت زراعتها معًا بخلايا WT iN (زرقاء) متماثلة اللواقح STXBP1- خلايا iN الطافرة التي تم إحداث الطفرة فيها بعد أسبوع واحد من تحريض خلية iN (سوداء). تنكس متماثل الزيجوت STXBP1- الخلايا العصبية الطافرة ذات دلالة إحصائية عالية في ظل جميع الظروف. ص & lt 0.01 ، أنوفا ثنائية الاتجاه. (د) متغاير الزيجوت STXBP1- خلايا iN الطافرة ملطخة للعلامة التغصنية MAP2. شريط النطاق: 100 ميكرومتر. (ه) الطول الكلي للتشجير (يسار) ، عدد الفروع (الوسط) ، وحجم سوما (يمين) محدد كمياً بخلايا iN المتحولة والمشتقة من نسختين منفصلتين من الخلايا الجذعية الجنينية الطافرة. (F) التشعبات من السيطرة وغير المتجانسة STXBP1- خلايا iN الطافرة ملطخة بـ MAP2 و synapsin لتصور المحطات قبل المشبكية. شريط النطاق: 10 ميكرومتر. (جي) كثافة (يسار) وحجم (يمين) النقاط النقطية الإيجابية للمشابك على طول التشعبات في متغاير الزيجوت STXBP1- خلايا iN الطافرة مشتقة من نسختين مستقلتين من الخلايا الجذعية الجنينية. تمثل أشرطة الخطأ يعني ± SEM. يشار إلى عدد من التجارب المستقلة التي أجريت في الرسوم البيانية.

منذ متماثل الزيجوت STXBP1- يبدو أن الخلايا العصبية الطافرة تتدهور (الشكل 1E) ، قمنا بقياس بقاء الخلايا العصبية مع متغاير الزيجوت أو متماثل الزيجوت STXBP1 الطفرات كدالة للوقت في الثقافة (الشكل 2C والشكل التكميلي 3A). وجدنا أن متغاير الزيجوت STXBP1لم تظهر الخلايا العصبية الطافرة أي فرق في البقاء على قيد الحياة مقارنة بالخلايا العصبية الضابطة ، في حين أن الخلايا العصبية متماثلة اللواقح STXBP1- أظهرت الخلايا العصبية الطافرة بالفعل فقدانًا نسبيًا للخلايا العصبية (

40 ٪) في أول نقطة زمنية تم فحصها (اليوم الخامس بعد تحريض خلية iN). متماثل STXBP1استمرت الخلايا العصبية الطافرة في الموت مع مرور الوقت. متماثل STXBP1-تدهورت الخلايا العصبية الطافرة أيضًا عندما تمت زراعتها مع الخلايا العصبية البشرية WT ، مما يشير إلى أن التنكس كان مستقلاً للخلايا (الشكل 2C). يتوافق هذا النمط الظاهري للتنكس العصبي مع الملاحظات في الفئران التأسيسية Munc18-1 – KO (31). علاوة على ذلك ، عندما قدمنا ​​متماثل الزيجوت STXBP1 الحذف بعد إنشاء خلايا iN بالفعل (بعد أسبوع واحد من تحريض خلية iN) ، لا تزال الخلايا العصبية تتحلل بسرعة ، مما يدل على أن بروتين Munc18-1 مطلوب لبقاء الخلايا العصبية بدلاً من مواصفات الخلايا العصبية (الشكل 2C). في نهج مستقل ثان لتقييم بقاء متماثل الزيجوت STXBP1- الخلايا العصبية الطافرة ، قمنا بقياس المقدار النسبي للإنسان جابده الحمض النووي الجيني و mRNA في خلايا WT و Munc18-1 المستنفدة بعد 4 أسابيع من الثقافة. أظهرت الخلايا العصبية الطافرة ما يقرب من 70 ٪ و 60 ٪ من موت الخلايا ، على التوالي ، بناءً على جابده مستويات الحمض النووي أو الرنا المرسال (الشكل التكميلي 3 و B و C). بسبب انحلالها ، لم يتم إجراء المزيد من الدراسات على متماثلة اللواقح STXBP1- الخلايا العصبية الطافرة.

اختبرنا بعد ذلك لتحديد ما إذا كان متغاير الزيجوت STXBP1كانت الخلايا العصبية الطافرة مشابهة للخلايا العصبية WT من حيث الشكل والتشجير وأعداد المشابك. لم تكشف المقاييس الكمية للطول الإجمالي للتشعبات وعدد الفروع التغصنية لكل خلية عصبية بالإضافة إلى حجمها سوما أي تغييرات (الشكل 2 و D و E). وبالمثل ، فشلت قياسات عدد نقاط الاشتباك العصبي لكل مقطع شجيري أو أحجام المشبك أيضًا في تحديد الاختلافات بين WT و STXBP1- الخلايا العصبية الطافرة (الشكل 2 و F و G). وهكذا ، متغاير الزيجوت STXBP1 الطفرة لا تعيق التطور الطبيعي للخلايا العصبية أو التشابك العصبي.

يقودها الفرضية القائلة بأن الخلايا العصبية البشرية متغايرة الزيجوت STXBP1 الطفرة قد تظهر تغيرات وظيفية ، قمنا بتحليل الخلايا العصبية الكهربية. تمشيا مع عدم وجود تغييرات مورفولوجية ، اكتشفنا عدم وجود تغييرات في الخواص الكهربائية الجوهرية (الشكل 3 ، أ - ج). ومع ذلك ، كشفت قياسات التيارات المثيرة بعد المشبكية المصغرة التلقائية (mEPSCs) عن نفس النمط الظاهري في الخلايا العصبية المستمدة من كل من استنساخ الخلايا ES المستقلة الطافرة: انخفاض كبير في تردد mEPSC دون تغيير في سعة mEPSC ، مما يدل على ضعف في إطلاق الناقل العصبي قبل المشبكي ( الشكل 4 ، أ و ب). أظهرت مخططات التوزيع التراكمي للأوقات الفاصلة أن هذا الضعف تم توزيعه بشكل موحد عبر المشابك ، أي أنه كان هناك تحول كبير جدًا إلى ترددات mEPSC المنخفضة في جميع المشابك (الشكل 4 ، A و B).

الخصائص الكهربائية الجوهرية الطبيعية في متغاير الزيجوت STXBP1- الخلايا العصبية الطافرة. (أ) متغاير الزيجوت STXBP1- لا تظهر خلايا iN الطافرة أي تغييرات في مقاومة الإدخال (يسار) أو السعة (يمين). تم تحليل الخلايا العصبية المشتقة من نسختين مختلفتين من الخلايا الجذعية الجنينية الطافرة كما هو محدد. (ب) آثار تمثيلية لتحليلات خصائص إطلاق النار المحتملة للتحكم والمتغايرة الزيجوت STXBP1- خلايا iN الطافرة. تم حقن الخلايا العصبية الموجودة في وضع المشبك الحالي مع زيادة النبضات الحالية (زيادات 10 باسكال). يظهر البروتوكول التجريبي في الأسفل. (ج) رسم بياني موجز لعتبات إطلاق النار المحتملة للعمل المحددة في خلايا iN المتحولة المتحولة والمتغايرة الزيجوت المستمدة من نسختين مختلفتين من الخلايا الجذعية الجنينية. تُظهر الرسوم البيانية الموجزة متوسط ​​± أرقام SEM للخلايا / الثقافات المستقلة التي تم تحليلها موضحة في الأشرطة.

انخفاض إطلاق ناقل عصبي عفوي في متغاير الزيجوت STXBP1- الخلايا العصبية البشرية الطافرة. (أ و ب) خلل في إطلاق ناقل عصبي عفوي في متغاير الزيجوت STXBP1- الخلايا العصبية البشرية الطافرة. تظهر الآثار التمثيلية لـ mEPSCs المسجلة في 1 ميكرومتر tetrodotoxin (TTX) من نسختين مختلفتين في الأعلى. الرسوم البيانية الموجزة لمعلمات mEPSC موضحة أدناه. الرسم البياني الأيسر التراكمي للفاصل الزمني المتداخل mEPSC (داخلي: متوسط ​​تردد mEPSC) يمينًا ، مؤامرة تراكمية لسعة mEPSC (داخلي: متوسط ​​السعة الصغيرة). **ص & lt 0.01، unpaired، 1-tailed’s ر اختبار للمقارنة بين الوسائل ***ص & lt 0.001 ، اختبار Kolmogorov-Smirnov للمقارنة بين التوزيعات التراكمية. تعرض الرسوم البيانية الموجزة يعني ± أرقام SEM للخلايا / الثقافات المستقلة التي تم تحليلها موضحة في الأشرطة.

لمزيد من توصيف انتقال متشابك في الخلايا العصبية المتحولة Munc18-1 ، قمنا بفحص الاستجابات المشبكية المستحثة. لاحظنا في الخلايا العصبية المستمدة من كل من استنساخ الخلايا الجذعية الجنينية الطافرة التي تكون متغايرة الزيجوت STXBP1 تسبب الطفرات في انخفاض كبير (

45 ٪) في العمل - أثار EPSCs المحتملة مماثلة للتغيير في تردد mEPSC (الشكل 5 ، A و B). تم أيضًا تقليل سعة EPSCs التي أثارها قطار التحفيز 10 هرتز / 10 ثانية (الشكل 5 و C و D). تم تخفيض سعة EPSC بشكل موحد في جميع أنحاء القطار 10 هرتز من حيث القيمة المطلقة (الشكل 5 د) ، لكن تحليلات EPSCs النسبية التي تم تطبيعها للاستجابة الأولى كشفت عن عدم وجود فروق بين التحكم و STXBP1- الخلايا العصبية الطافرة (الشكل 5E) ، مما يدل على أن اللدونة التشابكية قصيرة المدى لم تتغير.

متغاير الزيجوت STXBP1 الطفرات تضعف أثار إطلاق الناقل العصبي. (أ و ب) آثار الممثل (أ) ورسوم بيانية موجزة عن السعة (ب) من EPSCs أثارها إمكانات العمل المعزولة في السيطرة و STXBP1- الخلايا العصبية الطافرة مشتقة من نسختين مختلفتين من الخلايا الجذعية الجنينية. (ج) آثار تمثيلية من EPSCs أثارها 10 هرتز / 10 قطارات التحفيز الثانية في السيطرة وغير متجانسة الزيجوت STXBP1- الخلايا العصبية البشرية الطافرة. (د و ه) التحليلات الكمية لـ EPSCs التي أثارتها قطارات التحفيز 10 هرتز على أنها مطلقة (د) أو السعات النسبية المقيسة إلى الاستجابة الأولى (ه). يتم رسم السعات على كامل قطار مدته 10 ثوانٍ (اللوحات اليسرى) وعلى المحفزات العشر الأولى (اللوحات الوسطى) كدالة لرقم التحفيز ، بينما يظهر متوسط ​​السعات التي أثارتها المحفزات العشر الأخيرة في اللوحات اليمنى. لاحظ أنه بينما متغاير الزيجوت STXBP1- تظهر الخلايا العصبية الطافرة سعات مطلقة منخفضة بشكل موحد ، واللدونة المشبكية كما تعكسها السعات النسبية أمر طبيعي. (F و جي) قياسات الإطلاق الناجم عن السكروز مفرط التوتر لتقييم حجم RRP للحويصلات. تظهر اللوحات آثارًا تمثيلية (F) ورسوم بيانية موجزة لتحويل الشحن التراكمي كدالة للوقت (جي، يسار) أو من إجمالي متوسط ​​تحويل الرسوم (جي، حق). تُظهر الرسوم البيانية الموجزة متوسط ​​± أرقام SEM للخلايا / الثقافات المستقلة التي تم تحليلها موضحة في الأشرطة. تم إجراء مقارنات إحصائية بواسطة Student’s ر اختبار مقارنة متغاير الزيجوت STXBP1 المسوخ للضوابط. *ص & lt 0.05 **ص & lt 0.01 ***ص & lt 0.001.

يمكن تفسير النمط الظاهري المرصود ، من بين عوامل أخرى ، بانخفاض عدد المشابك أو انخفاض في حجم التجمع القابل للإفراج بسهولة (RRP) من الحويصلات لكل المشبك. أظهر تحليلنا المورفولوجي أعلاه أن أرقام المشابك لم تتغير في متغاير الزيجوت STXBP1- الخلايا العصبية الطافرة ، مع استبعاد الاحتمال الأول (الشكل 2 و F و G). وهكذا قمنا بقياس حجم RRP ، باستخدام التحفيز بواسطة السكروز مفرط التوتر كأداة لتقدير RRP (الشكل 5F والمرجع. 35). من المثير للدهشة أننا وجدنا أنه لم يتم تغيير حجم RRP ولا حركية إطلاقه بواسطة متغاير الزيجوت STXBP1 طفرة (الشكل 5G). وهكذا ، متغاير الزيجوت STXBP1 خفضت الطفرة من حجم إطلاق ناقل عصبي Ca 2+ بدون تغيير اللدونة على المدى القصير ، مما يشير إلى تأثير يعمل في اتجاه مجرى فتيلة الحويصلة في RRP ، ولكن في بداية إطلاق Ca 2+.

لمزيد من التحديد والتأكيد بشكل مستقل على النمط الظاهري القوي بشكل مدهش من متغاير الزيجوت STXBP1- الخلايا العصبية البشرية الطافرة ، استخدمنا علم البصريات الوراثي لتحليل الوصلات الوحدوية. نظرًا لأن مثل هذه التجارب ليست روتينية في هذا المجال بعد ، فقد طورنا واختبرنا طريقتين مختلفتين لهذه التحليلات ، وكلاهما قدم نتائج مماثلة (الشكلان 6 و 7).

متغاير الزيجوت STXBP1 تقلل الطفرات من إطلاق الناقل العصبي قبل المشبكي في المشابك الخلوية iN كما يتضح من التحليل البصري الوراثي للوصلات المشبكية الوحدوية. (أ) مخطط التدفق لتجارب خلايا iN الوراثي باستخدام قنوات متناثرة transfectionsrhodopsin. متغاير الزيجوت STXBP1- تم إنشاء خلايا iN للتحكم بالدم أو WT كما هو موصوف في الشكل 1 ، تم نقلها بشكل ضئيل في اليوم 21 باستخدام tdTomato-CHiEF (مشتق من تشانيلرودوبسين -2) ، وتم تحليلها عن طريق تثبيت التصحيح في اليوم 26. لتجارب الإنقاذ ، الفئران Munc18- تم نقل 1 cotransfected مع تشانيل رودوبسين في اليوم 21. (بد) تم مواجهة الصور المجهرية التمثيلية لخلايا iN المنقولة التي تعبر عن خلايا iN tdTomato-CHiEF (الحمراء) لـ MAP2 (الأخضر) والمشابك (الوردي). تظهر صور التكبير الأعلى للمناطق المعبأة على اليمين (B1 ، WT control B2 ، متغاير الزيجوت STXBP1- متحولة بدون إنقاذ B3 ، متخالف الزيجوت STXBP1- متحولة مع الإنقاذ). أشرطة النطاق: 100 ميكرومتر. (ه) رسم تخطيطي لتحليلات علم البصريات الوراثي للوصلات المشبكية الوحدوية. تم تنشيط tdTomato-CHiEF- الخلايا العصبية قبل المشبكية الإيجابية بواسطة نبضات ضوئية قصيرة ، وتم تسجيل EPSCs من الخلايا العصبية السلبية بعد المشبكية tdTomato-CHiEF. (F) آثار عينة من EPSCs أثار الضوء. يوضح الشريط الأسود فوق الآثار نبضة الضوء البالغة 2 مللي ثانية. (جي) مخططات موجزة توضح سعة EPSC (يسار) ومعامل التباين الخاص بها (يمين). عرض الرسوم البيانية يعني ± يُشار إلى عدد الخلايا / الثقافات المستقلة التي تم تحليلها في الأشرطة. *ص & lt 0.05 **ص & lt 0.01 ، للطالب ر اختبار.

متغاير الزيجوت STXBP1 تقلل الطفرات من إطلاق الناقل العصبي قبل المشبكي في المشابك التي تشكلها خلايا iN على الخلايا العصبية القشرية للفأر المزروعة كما يتضح من التحليل البصري الوراثي للوصلات المشبكية الوحدوية. (أ) مخطط التدفق لتجارب الخلايا الضوئية iN باستخدام الخلايا العصبية المزروعة بالماوس. متغاير الزيجوت STXBP1تم إنشاء الخلايا العصبية المتحولة أو WT كما هو موضح في الشكل 1 ، ولكن مع تعايش tdTomato-CHiEF. تمت زراعة خلايا iN مع فائض كبير من الخلايا العصبية القشرية للفأر في اليوم السابع وتم تحليلها عن طريق لقط التصحيح في اليوم 21. (ب) صور مجهرية تمثيلية للخلايا العصبية البشرية المنقولة بواسطة tdTomato-CHiEF (باللون الأحمر) والتي تمت زراعتها بشكل مشترك مع عصبونات الفئران القشرية الأولية في اليوم السابع وتحليلها في اليوم الحادي والعشرين. تم تمييز جميع الخلايا العصبية بـ MAP2 (أخضر) ، سينابسين (وردي) ، و DAPI (أزرق) ). شريط النطاق: 100 ميكرومتر. (ج) آثار عينة من EPSCs المستحث بالضوء المسجلة من الخلايا العصبية للفأر. (د) ملخص الرسوم البيانية لسعة EPSCs المستحثة بصريًا (يسار) ومعامل الاختلاف (يمين). تُظهر الرسوم البيانية الموجزة متوسط ​​± أرقام SEM للخلايا / الثقافات المستقلة التي تم تحليلها موضحة في الأشرطة. *ص & lt 0.05 **ص & lt 0.01 ***ص & lt 0.001 ، للطالب ر اختبار مقارنة متغاير الزيجوت STXBP1 المسوخ للضوابط.

في النهج الأول ، أنتجنا التحكم ومتغاير الزيجوت STXBP1- الخلايا العصبية الطافرة كما هو موصوف أعلاه (الشكل 1 د) ، ولكن تم نقل الخلايا العصبية بشكل ضئيل مع البلازميد الذي يعبر عن tdTomato-tagged and code-optimized channelrhodopsin variant tdTomato-CHiEF (36) ، إما بمفرده أو مع بناء إنقاذ Munc18-1 . تم إجراء عمليات Transfections في 21 يومًا بعد تحريض تمايز خلايا iN ، وتم تحليل الخلايا العصبية بعد 5 أيام من ترنسفكأيشن عن طريق ترقيع الخلايا العصبية غير المنقولة وقياس EPSCs الناجم عن نبضة 2 مللي ثانية من الضوء الأزرق (الشكل 6A). أكد الفحص المجهري الفلوري أن مجموعة فرعية صغيرة من الخلايا العصبية قد تم نقلها ، ولكن هذه الخلايا العصبية شكلت مشابكًا وفيرة على الخلايا العصبية غير المنقولة (الشكل 6 ، B-D). من خلال هذا التكوين التجريبي ، تمكنا من تحفيز مدخلات البصريات الوراثية بشكل انتقائي لمدخلات 1 أو ربما 2 من الخلايا العصبية قبل المشبكية ، والتي تعبر عن القناة العصبية على الخلايا العصبية المستهدفة بعد المشبكية المصححة وقياس الاستجابة لإمكانات الإجراء الفردي الناجم عن التحفيز البصري القصير (الشكل 6E) ). علاوة على ذلك ، من خلال cotransfecting بلازميد معبرًا عن Munc18-1 ، يسمح هذا التكوين التجريبي بتقييم قدرة WT Munc18-1 على إنقاذ النمط الظاهري المفترض. لاحظ أن الإنقاذ يتم حصريًا في الخلايا العصبية قبل المشبكية التي تعبر عن القناة العصبية ، في حين أن جميع الخلايا العصبية الأخرى متحولة ، ويتم إدخال الإنقاذ في الخلايا العصبية قبل المشبكية الطافرة بعد أن طورت هذه الخلايا العصبية التشعبات والمحاور وتشكيل نقاط الاشتباك العصبي.

أظهر التحفيز البصري الوراثي للخلايا العصبية قبل المشبكية أنه بالمقارنة مع الخلايا العصبية الضابطة ، متغاير الزيجوت STXBP1- عرضت الخلايا العصبية الطافرة انخفاضًا بمقدار ضعفين تقريبًا في سعة EPSC (الشكل 6 و F و G). كما هو متوقع لتحفيز 1 فقط وربما 2 من الخلايا العصبية قبل المشبكي ، كانت السعة المطلقة EPSC الناتجة عن التحفيز البصري الوراثي للخلايا العصبية الضابطة المتناثرة أقل بمقدار 10 أضعاف من تلك الناتجة عن التحفيز الكهربائي لجميع الخلايا العصبية (قارن الشكل 5 ب مع الشكل 6 ز). تتوافق سعة EPSC المستحثة بصريًا مع سعة 5 mEPSC تقريبًا ، بينما تتوافق EPSC المستحث كهربائيًا مع ما يقرب من 50 mEPSC (قارن الشكل 4 مع الشكل 6E) ، مما يشير إلى أن خلية عصبية واحدة تتشكل بين 6 و 10 جهات اتصال متشابكة وأن التحفيز الكهربائي ينشط حوالي 10 مرات أكثر من المشابك العصبية من التحفيز البصري الوراثي.

ملفت للنظر ، تعبير قبل المشبكي لـ WT Munc18-1 in STXBP1- الخلايا العصبية الطافرة قبل 5 أيام فقط من التسجيلات أنقذت النمط الظاهري تمامًا ، مما يدل على أن النمط الظاهري كان بسبب ضعف وظيفي قبل المشبكي يمكن عكسه بعد التطور (الشكل 6F). قمنا أيضًا بقياس معامل التباين كتقييم غير مباشر لاحتمالية إطلاق Ca 2+ ، لكننا لم نلاحظ أي تغيير في الخلايا العصبية الطافرة (الشكل 6G) ، بما يتوافق مع نقص التغيير في اللدونة على المدى القصير (الشكل 5).

في النهج الثاني الوراثي البصري ، قمنا بإصابة مشروط STXBP1- الخلايا الجذعية الجنينية الطافرة مع فيروس lentivirus الخاص بـ tdTomato-CHiEF في اليوم -1 مع الفيروسات البطيئة التي تُستخدم للحث على التمايز الموجه للخلايا الجذعية الجنينية إلى الخلايا العصبية ومع الفيروسات البطيئة التي تولد WT أو متغاير الزيجوت STXBP1- الخلايا العصبية الطافرة (الشكل 7 أ). بهذه الطريقة ، أعربت جميع خلايا iN عن المتغير CHIEF. قمنا بعد ذلك بزراعة خلايا iN في اليوم السابع مع وجود فائض من الخلايا العصبية القشرية الأولية المستزرعة حديثًا من الفئران حديثي الولادة ، بحيث تم خلط مجموعة متفرقة من خلايا iN التي تعبر عن القناة مع خلايا عصبية أكثر وفرة من الفئران (الشكل 7 ب). تم تصحيح الخلايا العصبية للفأر بعد يوم 21 ، وتم تحفيز الانتقال المتشابك باستخدام البصريات الوراثية في خلايا iN قبل المشبكي. وجدنا أنه ، كما في النهج الأول البصري الوراثي ، متغاير الزيجوت STXBP1 أدت الطفرة إلى انخفاض سعة EPSC مرتين تقريبًا ، مما يؤكد النمط الظاهري في هذا البروتوكول التجريبي (الشكل 7 و C و D). مرة أخرى ، لم نلاحظ أي تغيير في معامل الاختلاف. وهكذا ، من خلال نهجين تجريبيين متميزين ، أكدنا أن متغاير الزيجوت STXBP1 تسبب الطفرة انخفاضًا بمقدار ضعفين تقريبًا في قوة التشابك في الخلايا العصبية المثيرة التي ينتجها بروتوكول خلية iN.

في هذه الدراسة ، بحثنا في الخلايا العصبية البشرية سواء كانت متغايرة الزيجوت أو متماثلة اللواقح STXBP1 تسبب طفرات فقدان الوظيفة ضعفًا كبيرًا في نمو الخلايا العصبية ، والتشجير الشجيري ، وبقاء الخلايا العصبية ، والانتقال المتشابك. كان الدافع وراء هذا المشروع هو الملاحظة السريرية التي تشير إلى وجود طفرات متغايرة الزيجوت في STXBP1 الجين ، الذي يشفر بروتين اندماج الغشاء المشبكي Munc18-1 ، يسبب شكلاً حادًا من اعتلال الدماغ عند الأطفال يشار إليه باسم متلازمة أوهتهارا (20-22). على الرغم من أن مئات المرضى STXBP1 تم وصف الطفرات ، والآلية الممرضة لهذه الطفرات غير واضحة. في الفئران ، ثبت جيدًا أن الحذف متماثل اللواقح لـ STXBP1 ينتج كتلة كاملة في انتقال متشابك وتنكس عصبي (31) ، ولكن هذا الحذف متغاير الزيجوت STXBP1 يحث فقط النمط الظاهري الخفيف (37 ، 38). وبالتالي ، فإن السؤال الذي يطرح نفسه هو كيف متغاير الزيجوت STXBP1 الطفرة التي في الفئران لها تأثيرات متواضعة فقط يمكن أن تسبب ضعفًا سريريًا شديدًا لدى المرضى من البشر. لمعالجة هذا السؤال ، قمنا هنا بفحص النمط الظاهري من متغاير الزيجوت ومتماثل الزيجوت STXBP1 الطفرات في الخلايا العصبية البشرية ، مسترشدة بفكرة أن الخلايا العصبية البشرية قد تتفاعل مع هذه الطفرات بشكل مختلف عن الخلايا العصبية للفأر. في الواقع ، نجد أن متغاير الزيجوت STXBP1 يعد الحذف كافياً في الخلايا العصبية البشرية لإحداث خلل كبير في النقل المتشابك ، ولكنه لا يسبب تغييرًا في تطور الخلايا العصبية أو تشجيرها أو بقاءها على قيد الحياة. متماثل STXBP1 على النقيض من ذلك ، أدى الحذف إلى انخفاض كبير في بقاء الخلايا العصبية بطريقة مشابهة لتأثيرها على الخلايا العصبية للفأر.

النمط الظاهري من متغاير الزيجوت STXBP1- الخلايا العصبية البشرية الطافرة شديدة بما يكفي لتفسير العرض السريري لمرضى متلازمة أوهتهارا ، على الرغم من وجود تأثيرات إضافية للمرض. STXBP1 قد تساهم الطفرة التي تتجاوز تلك التي تم تحليلها هنا في العرض السريري. طبيعة النمط الظاهري الذي لاحظناه في متغاير الزيجوت STXBP1-تعد الخلايا العصبية البشرية المتحولة مفاجئة من ناحيتين. أولاً ، وجدنا أن انخفاضًا طفيفًا نسبيًا في Munc18-1 مع انخفاض متوافق في مستويات Syntaxin-1 تسبب في انخفاض كبير في إطلاق الناقل العصبي. تشير هذه النتيجة إلى أن Munc18-1 و Syntaxin-1 هما وحدتان فرعيتان لمركب مترابط يحد من معدل إطلاق الناقل العصبي حتى عندما تنخفض المستويات الإجمالية للبروتين جزئيًا فقط. يعتبر النمط الظاهري كبيرًا بشكل غير متوقع بالنسبة لطفرة متغايرة الزيجوت عند مقارنتها بالنمط الظاهري للفأر (31 ، 32 ، 37) ، ربما لأن الخلايا العصبية البشرية أكثر حساسية لفقدان Munc18-1 من الخلايا العصبية للفأر. ثانيًا ، وجدنا أن الزيجوت متخالف STXBP1 لم تسبب الطفرة انخفاضًا في RRP أو تؤثر بشكل انتقائي فقط على احتمال الإطلاق الأولي ، ولكنها بدلاً من ذلك أنتجت انخفاضًا منتظمًا في سعة EPSC عبر قطار التحفيز دون تغيير في اللدونة قصيرة المدى. يشير الانخفاض في تردد mEPSC دون تغيير في سعة mEPSC إلى أن الانخفاض في سعة EPSC يعكس ضعفًا في إطلاق Ca 2+ ، ولكن يبدو أن احتمال إطلاق Ca 2+ لم يتغير بناءً على اللدونة غير المتغيرة على المدى القصير. قمنا بتأكيد هذه الاستنتاجات بشكل مستقل باستخدام مناهج علم البصريات الوراثي التي حللت الانتقال المشبكي بين أزواج من الخلايا العصبية والتي أكدت أن حذف Munc18-1 المتغاير تسبب في انخفاض في قوة المشابك ولكن ليس في احتمال الإطلاق ، في هذه الحالة حسب تقييم معامل الاختلاف سعة EPSC (الشكلان 6 و 7). أظهرت تجارب علم البصريات الوراثي أيضًا أن النمط الظاهري تم إنتاجه بواسطة آلية قبل المشبكي بحتة ، حيث يمكن إنقاذه بواسطة WT Munc18-1 قبل المشبكي (الشكل 6) أو يمكن تحفيزه عن طريق الحذف قبل المشبكي لـ STXBP1 الجين (الشكل 7). علاوة على ذلك ، أظهرت تجارب علم البصريات الوراثي أن STXBP1-النمط الظاهري المتحولة لا يرجع إلى ضعف في نمو الخلايا العصبية ، ولكن إلى خلل في النهايات قبل المشبكية ، حيث يمكن إنقاذ النمط الظاهري في الخلايا العصبية بعد تشكل العصبونات والمشابك (الشكل 6). وبالتالي ، فإن الانخفاض في مستويات مركب Munc18-1 / Syntaxin-1 الناجم عن متغاير الزيجوت STXBP1 يبدو أن الطفرة (الشكل 2) تقلل من نشاط الحويصلات في اتجاه مجرى التمهيدي ولكن عند المنبع من Ca 2 + مما يؤدي إلى إطلاق. بصرف النظر عن الآلية التي تؤدي إلى هذا النمط الظاهري غير المعتاد ، يمكن استخدام مراقبة هذا النمط الظاهري والنهج في توليد الخلايا العصبية البشرية المتحولة بشكل مشروط وتحليل هذه الخلايا العصبية وظيفيًا كما هو معروض هنا لتطوير منصات فحص للأدوية التي قد تعكس الانخفاض في الإطلاق وقد يخفف من أعراض المرضى الذين يعانون من متغاير الزيجوت STXBP1 الطفرات.

في التجارب الحالية ، لم نستخدم النواقل الفيروسية المدمجة لتوليد مستنسخات من الخلايا الجذعية الجنينية الطافرة ، ولكننا أنشأنا طفرات شرطية سمحت بمقارنة الخلايا العصبية الطافرة والخلايا WT المشتقة من نفس الاستنساخ (أساسًا ، بعد حدوث الطفرات بشكل مشروط ، وليس خلية واحدة حدث الانقسام). علاوة على ذلك ، قمنا بتحليل نسختين متحولة مستقلة. وبالتالي ، يضمن تصميم هذه التجارب أن النمط الظاهري المرصود يرجع حقًا إلى الطفرة المقصودة ، حيث تم التحكم فيه بإحكام من أجل الخلفية الجينية والتغيرات النسيليّة وتأثيرات الإدراج الجيني (C.H.باك ، تي دانكو ، إم ويرنيغ ، وتي سي. Südhof ، ملاحظات غير منشورة). ومع ذلك ، تم إجراء جميع تجاربنا بناءً على خط خلية ES واحد ، خلايا H1 ، ولا نعرف مدى تأثر النمط الظاهري الذي لاحظناه بالخلفية الجينية. في المرضى البشر ، متغاير الزيجوت STXBP1 يبدو أن الطفرات تؤدي دائمًا إلى عروض سريرية مماثلة على عكس العديد من الطفرات الجينية البشرية الأخرى التي تنتج أنماطًا ظاهرية متنوعة. يشير هذا إلى أن الخلفية الجينية لا تلعب دورًا رئيسيًا في STXBP1 الجين ، ربما لأن Munc18-1 المشفر يؤدي وظيفة مركزية في حركة الغشاء ، ولا يمكننا في الوقت الحالي تقييم كيفية تأثير الخلفية الجينية على النمط الظاهري. ومع ذلك ، فإن الآثار الوظيفية للزيجوت المتخالف STXBP1 الطفرة التي نلاحظها هنا عميقة. نظرًا لأن Munc18-1 ضروري أيضًا لإطلاق الناقل العصبي في الخلايا العصبية المثيرة والمثبطة (31 ، 39) ، فمن المحتمل أن تكون هذه التأثيرات موجودة أيضًا في كليهما ، ومن المحتمل أن يساهم كلاهما في العرض السريري لمرضى متلازمة أوهتهارا. تشكل البيانات الحالية ما نعتقد أنه خطوة أولى نحو فهم كيفية تباين الزيجوت STXBP1 ينتج عن الطفرة متلازمة أوتهاهارا وتشير إلى أن الطفرة غير المتجانسة هي بالفعل مسببة للأمراض ، ولكن ستكون هناك حاجة إلى خطوات إضافية قبل النظر في الأساليب العلاجية المحتملة.

بنيات الفيروسية. تم استخدام التركيبات الفيروسية التالية: (أ) FUW-TetO-Ngn2-T2A-puromycin (حيث يشير FUW إلى F-ubiquitin-W) معربًا عن كاسيت TetO-Ngn2-T2A-puromycin (يقود محفز TetO التعبير عن الماوس كامل الطول Ngn2 و من بوروميسين عبر تسلسل الانقسام الببتيد T2A الشكل 1C والمرجع. يسبقه تسلسل توطين نووي (تحت سيطرة محفز سينابسين بشري خاص بالخلايا العصبية) لمراقبة موت الخلية (هـ) FUW-GFP :: Cre أو FUW-Flp للتعبير عن Cre- أو Flp-recombinase (f) FUW-oCHiEF: : tdTomato التي تعبر عن القناة الموسومة بـ tdTomato ، rhodopsin variant oCHiEF. تم استخدام اثنين من بنيات AAV لاستهداف الجينات (كما هو موضح في الشكل 1 أ). كان البناء الأول على النحو التالي: لاستهداف أليل الأول من STXBP1 على الكروموسوم 9 ، احتوى البناء على متواليات من المنطقة التي تشفر exon 2 محاطة بمواقع loxP وكاسيت مقاومة معكوس الاتجاه بجوار موقع 5 ′ loxP. احتوت كاسيت المقاومة على المروج PGK ، وجين مقاومة البوروميسين ، وتسلسل SV40 polyA. كانت كاسيت المقاومة محاطة بمواقع عسكرية. لإعادة التركيب المتماثل ، تضمن الذراع 5 للبناء 1.5 كيلو بايت من التسلسلات الموجودة في الجزء العلوي من exon 2. يحتوي الذراع 3 على 1.3 كيلو بايت من التسلسلات الموجودة في اتجاه مجرى exon 2. وكان البناء الثاني على النحو التالي: لاستهداف الثاني الأليل ، التسلسل الذي يشفر الجين المقاوم للبوروميسين للبنية الأولى تم تبادله مع جين مقاومة البلاستيدين. كل شيء آخر لم يتغير.

جيل الفيروسات. تم إنتاج فيروسات Lentivirus كما هو موصوف (29) في خلايا HEK293T (ATCC) عن طريق نقل العدوى مع 3 بلازميدات مساعدة (pRSV-REV ، pMDLg / pRRE ، وناقل التعبير البروتيني لفيروس التهاب الفم الحويصلي) مع 12 ميكروغرام من ناقل DNA العدسي و 6 ميكروغرام من كل منهما من DNA البلازميد المساعد لكل 75 سم 2 منطقة زراعة) باستخدام فوسفات الكالسيوم. تم حصاد فيروسات Lentivirus في الوسط 48 ساعة بعد تعداء ، تكوير عن طريق الطرد المركزي (49000) ز لمدة 90 دقيقة) ، معلق في MEM ، مقسم ، ومجمد عند -80 درجة مئوية. تم استخدام مستحضرات الفيروس فقط مع أكثر من 90 ٪ من كفاءة العدوى كما تم تقييمها بواسطة تعبير EGFP أو مقاومة البوروميسين للتجارب. تم استخدام AAV-DJ (40) لتقديم بنية الاستهداف لتوليد خلايا cKO. تم إنتاج AAV-DJ في خلايا HEK293T عن طريق النقل المشترك لمتجه pHelper و pDJ و AAV (8.5 ميكروغرام من الحمض النووي لكل 75 سم 2 منطقة زراعة) باستخدام فوسفات الكالسيوم. تم حصاد الخلايا بعد 72 ساعة من ترنسفكأيشن في PBS / 1 ملي مول EDTA وبعد دورة تجميد / ذوبان واحدة. تم جمع AAVs من السيتوبلازم باستخدام نوكلياز بنزوناز بتركيز نهائي قدره 50 وحدة / مل عند 37 درجة مئوية لمدة 30 دقيقة. بعد إزالة المعلق من حطام الخلية عن طريق الطرد المركزي البطيء (3000 ز لمدة 30 دقيقة) ، تم عزل AAVs بعد الطرد المركزي السريع (400000 ز لمدة 120 دقيقة) في iodixanol (تدرج من 15٪ إلى 60٪) من طبقة 40٪ ومركّز بشكل أكبر باستخدام أنبوب تركيز مركزي (100،000 MWCO ، Millipore UFC0910024) وفقًا للبروتوكول المقترح من الشركة المصنعة.

زراعة الخلايا. تم إجراء التجارب على النحو الموصوف (29). تم الحفاظ على خلايا H1 ES (موارد أبحاث WiCell) كخلايا خالية من المغذيات في وسط mTeSR1 (تقنيات الخلايا الجذعية). تمت زراعة خلايا الفئران الدبقية من الدماغ الأمامي لفئران حديثي الولادة WT CD1 (41). باختصار ، تم هضم متجانسات الدماغ الأمامي للفأر حديث الولادة باستخدام غراء و EDTA لمدة 20 دقيقة ، وتم فصل الخلايا عن طريق سحن قاسي لتجنب نمو الخلايا العصبية وطليها على قوارير T75 في DMEM مكملًا بنسبة 10 ٪ FBS. عند الوصول إلى التقاء ، تم تجريب الخلايا الدبقية واستبدالها بكثافة أقل بإجمالي 2 إلى 3 مرات لإزالة كميات ضئيلة من الخلايا العصبية للفأر قبل استخدام مزارع الخلايا الدبقية لإجراء تجربة زراعة مع خلايا iN.

استهداف الجينات في الخلايا الجذعية الجنينية. تم نقل خلايا H1 ES بواسطة AAVs التي تحتوي على البنية الأولى أو الثانية (الموصوفة أعلاه). تم استخدام التركيبة الأولى لتوليد خلايا جذعية جنينية جنينية متحولة شرطية متغايرة الزيجوت. تمت إضافة عقار الانتقاء وحفظه في وسط mTeSR1 حتى يومين بعد النقل. تم السماح للخلايا الجذعية الجنينية الباقية بالنمو إلى مستعمرات واختيارها بشكل فردي. تم تأكيد خمس مستعمرات مستهدفة بشكل صحيح من إجمالي 91 مستعمرة عن طريق فحص PCR باستخدام مجموعتين من PCRs مع تسلسل قليل من CATGTTAACCAGGATGGTCTCAATCT و ATAACTTCGTATAATGTATGCTATACGAAGTTAT أو ATAACTTCGTATAGCATACATTATACGAAGTTAT و CAAGATCCATCATTATACGAAGTTAT ، على التوالي. تم استخدام البنية الثانية لتوليد الخلايا الجذعية الجنينية الطافرة الشرطية المتماثلة اللواقح. تم تحقيق إعادة التركيب المتماثل عن طريق توصيل استنساخ متغاير الزيجوت لا. 1 واختيار الدواء اللاحق مع البلاستيدين والبوروميسين. تم تأكيد مستعمرتين مستهدفتين بشكل صحيح من أصل 80 مستعمرة عن طريق فحص PCR باستخدام oligosequences GGGGGAATGGAAGGTGAGTAGAAAGTA و TAACTGCCTGACCAGGTGTCTTTAAGA (يشار إليها باسم الاشعال رقم 2 ورقم 3 في الشكل 1A). تم التحقق من الاستئصال الناجح لـ exon 2 عند إعادة التركيب بواسطة Cre-recombinase - بوساطة باستخدام oligosequences: GGTGGGTTGGTTATGGCTCAGTAAAC و TAACTGCCTGACCAGGTGTCTTTAAGA (يشار إليها باسم الاشعال رقم 1 ورقم 3 في الشكل 1A).

البروتوكول القياسي لتوليد خلايا iN من الخلايا الجذعية الجنينية البشرية الشرطية الطافرة ولتفعيل الطفرات الشرطية. تم وصف توليد خلايا iN مسبقًا (29). باختصار ، عولجت الخلايا الجذعية الجنينية البشرية المستهدفة باستخدام Accutase (تقنيات الخلايا المبتكرة) وطليها كخلايا منفصلة في 24 لوحًا جيدًا (1 × 10 4 خلايا / بئر) في اليوم الثاني (الشكل 1 ب). تم طلاء الخلايا على أغطية Matrigel المغلفة (BD Biosciences) في mTeSR1 التي تحتوي على 2 ميكرومتر من ثيازوفيفين (BioVision). في اليوم الأول ، تمت إضافة الفيروسات البطيئة المحضرة كما هو موصوف أعلاه (0.3 ميكرولتر / بئر من صفيحة 24 بئر) في وسط mTeSR1 جديد يحتوي على بوليبرين (8 ميكروغرام / مل ، Sigma-Aldrich). تم إصابة نوعين مختلفين من فيروسات lentiviruses: الفيروسات البطيئة المستخدمة لتحريض خلية iN ، كما هو موصوف (29) ، والفيروسات البطيئة التي تعبر إما عن Flp-recombinase (لاستعادة جين WT) أو Cre-recombinase (لإنشاء أليل فارغ) تحت السيطرة مروج يوبيكويتين (الشكل 1 د). في اليوم 0 ، تم استبدال وسط الثقافة بـ N2 / DMEM / F12 / NEAA (Invitrogen) الذي يحتوي على BDNF البشري (10 نانوغرام / مل ، PeproTech) ، NT-3 البشري (10 نانوغرام / مل ، PeproTech) ، والفأر Laminin-1 (0.2 ميكروغرام / مل ، Invitrogen). تمت إضافة Doxycycline (2 ميكروغرام / مل ، Clontech) في اليوم 0 للحث على التعبير الجيني TetO والاحتفاظ بها في الوسط حتى نهاية التجربة. في اليوم الأول ، بدأ اختيار بوروميسين لمدة 24 ساعة (1 ميكروغرام / مل). في اليوم الثاني ، تمت إضافة خلايا الفئران الدبقية في وسط عصبي عصبي مكمل بـ B27 / Glutamax (Invitrogen) الذي يحتوي على BDNF و NT3 و Laminin-1 Ara-C (2 ميكرومتر ، Sigma-Aldrich) تمت إضافته إلى الوسط لمنع تكاثر الخلايا النجمية. بعد اليوم الثاني ، تم تبادل 50٪ من الوسط في كل بئر كل يومين. تمت إضافة FBS (2.5 ٪) إلى وسط الاستزراع في اليوم العاشر لدعم بقاء الخلايا النجمية ، وتم فحص خلايا iN بعد 21 يومًا على الأقل في معظم التجارب.

توليد خلايا iN لتجارب علم البصريات الوراثي. بالنسبة لتجارب ترنسفكأيشن القناة (tdTomato-CHiEF) (الشكل 6) ، تم نقل خلايا iN المنتجة باستخدام البروتوكول القياسي بشكل ضئيل بواسطة فوسفات الكالسيوم في اليوم 21 باستخدام متجه تعبير tdTomato-CHiEF بدون أو مع cotransfection مع ناقل تعبير Munc18-1 ( FSW الفئران Munc18-1). تم تحليل الخلايا بعد 5 أيام على الأقل لضمان تعبير تشانيلرودوبسين قوي. بالنسبة لتجارب زراعة الفئران (الشكل 7) ، تم تعديل البروتوكول القياسي لإنتاج خلايا iN عن طريق العدوى المشتركة في اليوم الأول مع فيروس lentivirus إضافي لـ tdTomato-CHiEF ، وتم إضافة الخلايا القشرية الماوس الأولية التي تم تشريحها وفصلها حديثًا في اليوم السابع. تم تحليلها بعد 14 يومًا (اليوم 21).

تجارب التألق المناعي والتألق المناعي تم إجراء تجارب التألق المناعي بشكل أساسي كما هو موصوف (29). باختصار ، تم تثبيت خلايا iN المزروعة في بارافورمالدهيد 4٪ في PBS لمدة 20 دقيقة عند درجة حرارة الغرفة ، وغسلها 3 مرات باستخدام PBS ، وحضنت في 0.2٪ Triton X-100 في PBS لمدة 10 دقائق في درجة حرارة الغرفة. تم حظر الخلايا في PBS التي تحتوي على 5٪ من مصل الماعز لمدة ساعة في درجة حرارة الغرفة. تم تطبيق الأجسام المضادة الأولية طوال الليل عند 4 درجات مئوية ، وتم غسل الخلايا في برنامج تلفزيوني 3 مرات ، وتم تطبيق الأجسام المضادة الثانوية ذات العلامات الفلورية (Alexa Fluor ، 1: 1000) لمدة ساعة واحدة في درجة حرارة الغرفة. تم استخدام الأجسام المضادة التالية في تجارب الكيمياء الخلوية المناعية: MAP2 (Sigma-Aldrich 1: 1،000) ، Synapsin (E028 1: 2000) ، Nanog (Millipore 1: 1000) ، Oct4 (sc-8628 ، Santa Cruz Biotechnology Inc. 1: 1000) ، SSEA-4 (ميليبور 1: 1000) ، Tra-1-60 (ميليبور 1: 1000) ، و Tra-1-81 (ميليبور 1: 1000). تم تصور مورفولوجيا الخلايا العصبية التغصنية بواسطة الكيمياء المناعية MAP2. تم إجراء جميع تجارب التكتل المناعي الكمي باستخدام أجسام مضادة ثانوية معالج باليود (125 I) كما هو موصوف (42). تم فصل العينات بواسطة SDS-PAGE ونقلها إلى أغشية النيتروسليلوز. تم حظر البقع في محلول ملحي Tris-buffered يحتوي على 0.1 ٪ توين 20 (سيغما الدريتش) و 5 ٪ حليب خالي من الدسم لمدة ساعتين في درجة حرارة الغرفة. تم تحضين الغشاء المسدود في حاجز عازل يحتوي على الجسم المضاد الأولي طوال الليل عند 4 درجات مئوية ، متبوعًا بـ 3 إلى 5 غسلات. تم تحضين الغشاء المغسول في محلول مانع يحتوي إما على جسم مضاد ثانوي مترافق مع HRP (MP Biomedicals ، 1: 8000) لمدة ساعتين عند درجة حرارة الغرفة أو 125 جسم مضاد ثانوي يحمل علامة I (PerkinElmer ، 1: 1000) طوال الليل عند درجة حرارة الغرفة. تم تطوير اللطخات المناعية HRP مع تلألؤ كيميائي محسن (GE Healthcare). تم تعريض 125 لطخة I إلى شاشة phosphorimager (Amersham) لمدة 1 إلى 7 أيام وتم مسحها ضوئيًا باستخدام ماسح Storm (GE Healthcare) ، متبوعًا بالقياس الكمي باستخدام برنامج ImageQuant (GE Healthcare). بالنسبة للكشف المناعي ، تم استخدام الأجسام المضادة التالية: NeuN (ABN78 ، Millipore) ، TuJ1 (MMS-435P ، Covance) ، مركب 1/2 (L668) ، Munc18 (610336 ، BD Transduction) ، SNAP25 (P913) ، synaptobrevin-2 ( P939) ، synaptotagmin1 (41.1 ، Synaptic Systems) ، synapsin (E028) ، Syntaxin-1 (438B) ، β-actin (A1978 ، Sigma-Aldrich) ، Syntaxin-16 (4398) ، synaptophysin (Synaptic Systems ، 7.2) ، الناتج المحلي الإجمالي - مثبط التفكك (Synaptic Systems ، GDI) (81.2) ، بروتين يحتوي على فاسولين (Synaptic Systems ، VCP) ، سيرين / ثريونين كيناز المرتبط بالكالودولين (CASK ، N3927) ، L1CAM (UJ127.11 ، Sigma-Aldrich) ، و SynCAM (T2412).

تحليلات التعبير الجيني لتحليلات PCR (RT-PCR) الكمية في الوقت الحقيقي للخلايا المستنبتة المجمعة ، تم عزل الحمض النووي الريبي باستخدام RNAqueous Kit (النظم الحيوية التطبيقية) ، وتم معالجتها باستخدام DNase (النظم البيولوجية التطبيقية) ، ونسخها العكسي باستخدام Superscript III (Invitrogen). تم قياس مستويات mRNA بواسطة اختبار RT-PCR باستخدام نظام Applied Biosystems 7900HT Fast Real-Time PCR وبرنامج تحليل RQ.

القياس الكمي للتشكل والكثافة المشبكية والبقاء. تم إجراء تحليلات التشكل والكثافة المشبكية بشكل أساسي كما هو موصوف (43). باختصار ، تم الحصول على الصور باستخدام كاميرا Leica DFC400 الرقمية ، المرفقة بمجهر Leica DMIL LED المقلوب بهدف × 10 ، مدفوعًا ببرنامج اكتساب الصور Leica Application Suite. تمت إعادة بناء الصور من 30 إلى 40 خلية عصبية لكل حالة باستخدام تطبيق MetaMorph neurite ، وسجل إجمالي الطول الشجيري ، ونقاط التفرع الشجيري ، ومنطقة سوما. لتحليلات نقاط synapsin ، تم الحصول على الصور باستخدام نظام مجهر متحد البؤر Nikon A1RSi وتم تحديد كثافة النقاط باستخدام برنامج Nikon NIS-Elements. تم إجراء تحليلات بقاء خلايا iN بطريقتين. أولاً ، تمت مراقبة البقاء على قيد الحياة مباشرة باستخدام صور نوى خلية iN تعبر عن mCherry في نفس الموضع من طبق الثقافة المأخوذة كل يوم. تم تحديد عدد الخلايا باستخدام برنامج ImageJ (http://imagej.nih.gov/ij/). لكل حالة تجريبية ، تم اعتبار متوسط ​​الصور من 20 إلى 30 بئراً استزراعًا (لصفيحة من 96 بئرًا) ن = 1. في المجموع ، متوسط ن = 3 محسوبة. ثانيًا ، المقدار الإجمالي للجينوم جابده الجين DNA و جابده تمت مراقبة mRNA في خلايا iN بواسطة PCR الكمي. تم جمع عينات الحمض النووي والحمض النووي الريبي من خلايا iN بعد 4 أسابيع من الثقافة باستخدام DNeasy Blood & amp Tissue Kit (كتالوج QIAGEN 69504) أو RNAqueous-Micro Kit (كتالوج Ambion1931) ، على التوالي. تم قياس تركيزات الحمض النووي والحمض النووي الريبي بواسطة NanoDrop 1000 Spectrophotometer. تم إجراء RT-PCRs الكمي باستخدام USB VeriQuest Probe One-Step qRT-PCR Master Mix (كتالوج Affymetrix 75700) على نظام PCR التطبيقي سريع الوقت 7900HT وبرنامج تحليل RQ. تم إجراء RT-PCR وفقًا للبروتوكول المقترح من الشركة المصنعة: دورة واحدة عند 50 درجة مئوية لمدة 15 دقيقة دورة واحدة عند 95 درجة مئوية لمدة 10 دقائق 35 دورة من 95 درجة مئوية لمدة 15 ثانية و 60 درجة مئوية لمدة 30 ثانية. تم استخدام مقايسة GAPDH PrimeTime الخاصة بتسلسل الماوس (تقنيات الحمض النووي المتكاملة) كعنصر تحكم في تحميل رقم الخلية لثقافة iN عن طريق الكشف عن أرقام الخلايا الدبقية. تم استخدام مقايسة GAPDH PrimeTime (تقنيات الحمض النووي المتكاملة) الخاصة بالتسلسل البشري للكشف عن وفرة الإنسان جابده على كل من مستويات DNA و mRNA في خلايا iN المتحكمة والمتحولة. تم تقدير أرقام خلايا iN النسبية بواسطة مستويات GAPDH البشرية التي تم تطبيعها لمستويات GAPDH بالماوس. كانت تسلسل اختبارات PrimeTime على النحو التالي: مسبار GAPDH للماوس: TGTTCCAGTATGACTCCACACTCACGG التمهيدي الأمامي: التمهيدي العكسي GTGGCAAAGTGGAGATTGTG: التمهيدي العكسي TTGACTGTGCCGTTGAATTG مسبار GAPDH البشري: مسبار CAGCAAGCACAAGGTGT: primer PRIMERAGCACAAGGTGC:

تجارب الفيزيولوجيا الكهربية القياسية. في خلايا iN المستزرعة ، تم تسجيل إمكانات العمل في تكوين الخلية الكاملة المشبك الحالي في درجة حرارة الغرفة (محلول الماصة: 123 ملي مولار من غلوكونات ، 10 ملي مول كلوريد ، 1 ملي مولار كلوريد2، 10 مم HEPES-KOH ، درجة الحموضة 7.2 ، 1 مم EGTA ، 0.1 ملي كلوريد الكالسيوم2، 1 ملم ك2ATP ، 0.2 ملي مولار Na4GTP ، و 4 ملي جلوكوز). تم الاحتفاظ بإمكانيات الغشاء بالقرب من 65 مللي فولت ، وتم حقن تيارات الخطوة لاستنباط إمكانات العمل بزيادات قدرها 20 باسكال. تمت مراقبة انتقال متشابك وتيارات تعتمد على الجهد للخلية بأكملها في وضع مشبك الجهد للخلية بأكملها (محلول الماصة: 120 ملي مولار كلوريد الصوديوم ، 5 ملي مول كلوريد الصوديوم ، 1 ملي مولار كلوريد الصوديوم2، 10 ملم HEPES-NaOH ، درجة الحموضة 7.4 ، 10 ملم EGTA ، 3 ملم MgATP ، 0.3 ملم NaGTP ، و 10 ملم QX-314). احتوى محلول الحمام في جميع التجارب على ما يلي: 140 ملي كلوريد الصوديوم ، 5 ملي كلوريد الصوديوم ، 2 ملي مول كلوريد الصوديوم2، 2 ملي MgCl2، 10 ملي HEPES-NaOH ، ودرجة الحموضة 7.4 ، و 10 ملي جلوكوز. تم قياس الاستجابات المتشابكة كما هو موضح سابقًا (44). تم تشغيل الاستجابات المشبكية المستحثة عن طريق الحقن الحالي 1 مللي ثانية من خلال قطب كهربائي محلي خارج الخلية (قطب كهربائي ثنائي القطب متحد المركز ، كتالوج CBAEC75) مع نموذج 2100 محفز نبض معزول (أنظمة AM) ، وتم تسجيلها في وضع المشبك الجهد باستخدام Multiclamp 700B مكبر للصوت Clampex 10.4 البيانات برمجيات الاقتناء (الأجهزة الجزيئية). تم ترقيم البيانات عند 10 كيلو هرتز باستخدام مرشح تمرير منخفض 2 كيلو هرتز. تم تحليل البيانات باستخدام Clampfit 10.4 (Axon Instruments). تمت إزالة التحف التحفيزية للاستجابات المشبكية المستحثة للتمثيل الرسومي.

تجارب الفيزيولوجيا الكهربية الوراثية. في التجارب التي تستخدم خلايا iN المنقولة بشكل ضئيل والتي تعبر عن tdTomato-CHiEF ، تم التعرف على الخلايا المنقولة عن طريق الفحص المجهري الفلوري ، وتم تصحيح خلايا iN غير الفلورية المحيطة التي تم تصويرها عبر بصريات مدينة دبي للإنترنت. تم بعد ذلك قياس EPSCs كدالة لنبضات 2 مللي ثانية من الضوء الأزرق (470 نانومتر) الناتجة عن مصدر الضوء Lambda DG-4 (Sutter Instruments). تم استخدام ألياف بصرية متصلة بمكثف ثنائي المنافذ لتوجيه النبض إلى المجهر. تم إجراء التجارب باستخدام الخلايا العصبية القشرية للفأر المزروعة بشكل مشابه ، باستثناء أن الخلايا العصبية للفأر المحيطة بخلايا tdTomato-CHiEF التي تعبر عن خلايا iN البشرية قد تم ترقيعها.

عرض البيانات والإحصاءات. جميع البيانات المعروضة تعني ± SEM تم إجراء جميع التحليلات الإحصائية باستخدام الطالب ثنائي الذيل ر اختبار (أو مشار إليه بطريقة أخرى) ، أو اختبار ANOVA ثنائي الاتجاه ، أو اختبار KS لمقارنة عينة الاختبار بعينة التحكم التي تم فحصها في نفس التجارب.

الموافقة على الدراسة. تمت الموافقة على الدراسة الحالية من قبل الإشراف على أبحاث الخلايا الجذعية (SCRO) في مكتب الامتثال البحثي بجامعة ستانفورد ، جامعة ستانفورد (SCRO 518: دراسة أمراض الدماغ التي تؤثر على الانتقال التشابكي باستخدام الخلايا العصبية التي يسببها الإنسان). تمت الموافقة على التجارب التي تشمل الحيوانات من قبل ستانفورد IACUC ، مكتب الامتثال البحثي لرعاية حيوانات المختبر (APLAC) ، جامعة ستانفورد.


مراجع

مالي ، P. وآخرون. هندسة الجينوم البشري الموجهة RNA عبر Cas9. علم 339, 823–1278 (2013)

Hsu، P. D.، Lander، E. S. & amp Zhang، F. تطوير وتطبيقات CRISPR-Cas9 لهندسة الجينوم. زنزانة 157, 1262–1278 (2014)

كونغ ، ل. وآخرون. هندسة الجينوم المتعدد باستخدام أنظمة CRISPR / Cas. علم 339, 819–823 (2013)

داو ، إل إي وآخرون. محرض في الجسم الحي تحرير الجينوم باستخدام CRISPR-Cas9. Nature Biotechnol. 33, 390–394 (2015)

بلات ، آر جيه وآخرون. تدق الفئران CRISPR-Cas9 لتحرير الجينوم ونمذجة السرطان. زنزانة 159, 440–455 (2014)

وانج هـ وآخرون. جيل واحد من الفئران يحمل طفرات في جينات متعددة بواسطة هندسة الجينوم CRISPR / Cas بوساطة. زنزانة 153, 910–918 (2013)

كانفر ، إم سي وآخرون.توصيف كفاءة الحذف الجينومي بوساطة تكرارات متناوبة متباعدة بشكل منتظم (كريسبر) / نظام نوكلياز Cas9 في خلايا الثدييات. J. بيول. تشيم. 289, 21312–21324 (2014)

يانغ ، هـ وآخرون. جيل واحد من الفئران التي تحمل المراسل والأليلات الشرطية بواسطة هندسة الجينوم CRISPR / Cas بوساطة. زنزانة 154, 1370–1379 (2013)

إينوي ، م وآخرون. الجيل السريع من نماذج الماوس مع طفرات نقطية محددة بواسطة نظام CRISPR / Cas9. علوم. اعادة عد. 4, 5396 (2014)

هاس ، سي وآخرون. تسبب الطفرة السويدية ظهور مرض ألزهايمر مبكرًا عن طريق انقسام بيتا سيريزاز داخل المسار الإفرازي. نيتشر ميد. 1, 1291–1296 (1995)

المجموعة التعاونية لمرض الزهايمر. هيكل بريسنيلين 1 (S182) الجين والتعرف على ستة طفرات جديدة في العائلات التي ظهرت في وقت مبكر من مرض الزهايمر. طبيعة الجينات. 11, 219–222 (1995)

Jiang، W.، Bikard، D.، Cox، D.، Zhang، F. & amp Marraffini، L.A. تحرير RNA الموجه للجينومات البكتيرية باستخدام أنظمة CRISPR-Cas. Nature Biotechnol. 31, 233–239 (2013)

Yang، L. et al. تحسين تحرير جينوم الخلايا الجذعية البشرية الخالية من الندبات. الدقة الأحماض النووية. 41, 9049–9061 (2013)

كلاينستيفر ، ب. وآخرون. نوكليازات CRISPR-Cas9 المهندسة مع خصائص PAM المتغيرة. طبيعة سجية 523, 481–485 (2015)

Bialk، P.، Rivera-Torres، N.، Strouse، B. & amp Kmiec، E.B. تنظيم نشاط تحرير الجينات الموجه بواسطة أليغنوكليوتيدات أحادية الشريطة وأنظمة CRISPR / Cas9. بلوس واحد 10، e0129308 (2015)

إليوت ، ب ، ريتشاردسون ، سي ، ويندرباوم ، جيه ، نيكولوف ، جيه إيه ، أمبير جاسين ، إم مسارات تحويل الجينات من إصلاح كسر الخيط المزدوج في خلايا الثدييات. مول. زنزانة. بيول. 18, 93–101 (1998)

Beumer، K. J.، Trautman، J.K، Mukherjee، K. & amp Carroll، D. علم الوراثة الجينوميات (G3) 3, 657–664 (2013)

Rivera-Torres، N.، Strouse، B.، Bialk، P.، Niamat، R.A & amp Kmiec، E.B. يؤثر موقع انقسام الحمض النووي بواسطة TALENs وتزامن الخلية على تكرار تحرير الجينات الموجه بواسطة قليلات النوكليوتيدات أحادية السلسلة. بلوس واحد 9، e96483 (2014)

تاغيان ، دي جي وأمبير نيكولوف ، جيه إيه ، تحفز فواصل الكروموسومات المزدوجة على تحويل الجينات بتردد عالٍ في خلايا الثدييات. مول. زنزانة. بيول. 17, 6386–6393 (1997)

جوتز ، جيه ، وأمب إيتنر ، إل م. نماذج حيوانية لمرض الزهايمر والخرف الجبهي الصدغي. القس الطبيعة. 9, 532–544 (2008)

ياغي ، ت. وآخرون. نمذجة مرض الزهايمر العائلي بالخلايا الجذعية المستحثة متعددة القدرات. همم. مول. جينيه. 20, 4530–4539 (2011)

إسرائيل ، م. وآخرون. استقصاء مرض الزهايمر المتقطع والعائلي باستخدام الخلايا الجذعية المستحثة متعددة القدرات. طبيعة سجية 482, 216–220 (2012)

كوندو ، ت. وآخرون. تكشف نمذجة مرض الزهايمر باستخدام خلايا iPSCs عن أنماط ظاهرية للضغط مرتبطة بـ Aβ داخل الخلايا واستجابة الأدوية التفاضلية. الخلية الجذعية للخلايا 12, 487–496 (2013)

موراتور ، سي آر وآخرون. تغير طفرة APPV717I من مرض الزهايمر العائلي معالجة APP وتعبير تاو في الخلايا العصبية المشتقة من iPSC. همم. مول. جينيه. 23, 3523–3536 (2014)

سبرول ، إيه إيه وآخرون. التوصيف والتنميط الجزيئي لمرض الزهايمر العائلي PSEN1 المشتق من السلالات العصبية المشتقة من iPSC. بلوس واحد 9، e84547 (2014)

وودروف ، جي وآخرون. تؤدي طفرة presenilin-1 ΔE9 إلى انخفاض نشاط-secretase ، ولكن ليس فقدانًا تامًا لوظيفة PS1 ، في الخلايا الجذعية البشرية المتجانسة. مندوب الخلية. 5, 974–985 (2013)

Lin، S.، Staahl، B. T.، Alla، R.K & amp Doudna، J.A. هندسة الجينوم البشري الموجهة بالتماثل المعزز من خلال التحكم في توقيت تسليم CRISPR / Cas9. eLife 3، e04766 (2015)

يو ، سي وآخرون. تعزز الجزيئات الصغيرة تحرير جينوم كريسبر في الخلايا الجذعية متعددة القدرات. الخلية الجذعية للخلايا 16, 142–147 (2015)

ماروياما ، ت. وآخرون. زيادة كفاءة التحرير الدقيق للجينوم باستخدام تقنية CRISPR-Cas9 عن طريق تثبيط الانضمام إلى الأطراف غير المتجانسة. Nature Biotechnol. 33, 538–542 (2015)

تشو ، في ت. وآخرون. زيادة كفاءة الإصلاح الموجه بالتماثل من أجل التحرير الجيني الدقيق الناجم عن تقنية CRISPR-Cas9 في خلايا الثدييات. Nature Biotechnol. 33, 543–548 (2015)

فو ، واي وآخرون. الطفرات عالية التردد خارج الهدف التي تحدثها نوكليازات كريسبر-كاس في الخلايا البشرية. Nature Biotechnol. 31, 822–826 (2013)

كاهلر ، دي جيه وآخرون. طرق محسنة لإعادة برمجة الخلايا الليفية الجلدية البشرية باستخدام الفرز الخلوي المنشط الفلوري. بلوس واحد 8، e59867 (2013)

كوان ، سي أ وآخرون. اشتقاق سلالات الخلايا الجذعية الجنينية من الكيسة الأريمية البشرية. إنجل. جيه ميد. 350, 1353–1356 (2004)

Goecks ، J. ، Nekrutenko ، A. & amp Taylor ، J. & amp The Galaxy Team. المجرة: نهج شامل لدعم البحوث الحاسوبية التي يسهل الوصول إليها والقابلة للتكرار والشفافية في علوم الحياة. جينوم بيول. 11، R86 (2010)

بلانكنبرج دي وآخرون. المجرة: أداة تحليل الجينوم على شبكة الإنترنت للتجربة. بالعملة. بروتوك. مول. بيول. الفصل 19 ، الوحدة 19.10.1–21 (2010)

Andrews، S. FastQC: أداة لمراقبة الجودة لبيانات تسلسل إنتاجية عالية. (http://www.bioinformatics.babraham.ac.uk/projects/fastqc)

Zhang، J.، Kobert، K.، Flouri، T. & amp Stamatakis، A. PEAR: دمج قراءة مقترنة بنهاية سريعة ودقيقة من Illumina. المعلوماتية الحيوية 30, 614–620 (2014)

Pearson، W. R.، Wood، T.، Zhang، Z. & amp Miller، W. مقارنة تسلسل الحمض النووي مع تسلسل البروتين. علم الجينوم 46, 24–36 (1997)

بلانكنبرج دي وآخرون. معالجة بيانات FASTQ مع Galaxy. المعلوماتية الحيوية 26, 1783–1785 (2010)

Li، H. & amp Durbin، R. محاذاة قراءة طويلة ودقيقة مع تحويل Burrows-Wheeler. المعلوماتية الحيوية 26, 589–595 (2010)

تساي ، س. كيو وآخرون. نوكليازات FokI الموجهة بتقنية Dimeric CRISPR RNA لتحرير الجينوم عالي التحديد. Nature Biotechnol. 32, 569–576 (2014)

Koike-Yusa، H.، Li، Y.، Tan، E.-P.، Velasco-Herrera، M.DC & amp Yusa، K. Nature Biotechnol. 32, 267–273 (2014)

فريق R Core. R: لغة وبيئة للحوسبة الإحصائية. (مؤسسة R للحوسبة الإحصائية ، 2015)

Zhu، Z.، González، F. & amp Huangfu، D. منصة iCRISPR لتحرير الجينوم السريع في الخلايا الجذعية البشرية متعددة القدرات. طرق الانزيم. 546, 215–250 (2014)

هيل ، جي تي وآخرون. محلل ذروة بولي: طريقة وبرامج لتحديد indels غير معروف باستخدام تسلسل Sanger لمنتجات تفاعل البلمرة المتسلسل. ديف. دين. 243, 1632–1636 (2014)

Cradick، T. J.، Qiu، P.، Lee، C.M، Fine، E. J. & amp Bao، G. COSMID: أداة قائمة على الويب لتحديد والتحقق من المواقع غير المستهدفة لـ CRISPR / Cas. مول. هناك. احماض نووية 3، e214 (2014)

شي ، واي. ، كيروان ، ب ، وأمب ليفيسي ، إف.جيه موجه تمايز الخلايا الجذعية البشرية متعددة القدرات إلى الخلايا العصبية في القشرة الدماغية والشبكات العصبية. بروتوكولات الطبيعة 7, 1836–1846 (2012)

ران ، إف إيه وآخرون. شق مزدوج بواسطة CRISPR Cas9 الموجه من RNA لتحسين خصوصية تحرير الجينوم. زنزانة 154, 1380–1389 (2013)

Jonsson، T. et al. طفرة في تطبيق يقي من مرض الزهايمر والتدهور المعرفي المرتبط بالعمر. طبيعة سجية 488, 96–99 (2012)


مقدمة

يتم تعريف التكامل المتوازي على أنه قدرة أليلين متغيرين تفاضليًا على العمل معًا بشكل أفضل مما يمكن لأي منهما بمفرده. على الرغم من شبه الشمولية في الكائنات الحية الدنيا [1] ، إلا أنه نادرًا ما يتم النظر في قدرتها على المساهمة في عدم التجانس السريري في الأمراض التي تصيب الإنسان. يقتصر الدليل على التكامل المتوازي في المواقع ذات الصلة سريريًا على الدراسات البيوكيميائية والقائمة على الخلايا لحفنة من الاضطرابات الأيضية مع وجود عيوب في الإنزيمات بما في ذلك propinyl-CoA carboxylase [2] ، argininosuccinate lyase [3] ، galactose-1-phosphate uridylyltransferase [4] ] و methylmalonyl CoA mutase [5].

الزيجوت المتغاير المركب هم أفراد يحملون أليلين متحولين مختلفين من نفس الجين. في حالة عدم وجود أليل سائد (من النوع البري [wt]) ، يمكن أن تؤدي التفاعلات الجينية بين الأليلات المتنحية (المشار إليها هنا باسم & # x0201cbiallic & # x0201d effects) إلى نتائج نمطية مختلفة بما في ذلك التكامل المتوازي. على الرغم من أن تحسين أعراض المرض عن طريق التكامل المتوازي من شأنه أن يخلق تحيزًا أكيدًا في العيادة ، إلا أن الافتقار إلى الأدلة المتعلقة بالتكامل المتوازي أو التأثيرات الأخرى للبيليلي في المرض البشري يرجع على الأرجح إلى صعوبة التمييز بين هذه التأثيرات من البيئة والخلفية الجينية.

XPD يشفر أحد مكوِّني هليكاز للنسخ القاعدية / عامل إصلاح الحمض النووي IIH (TFIIH) ، وهو مركب من عشر وحدات فرعية ومتعدد الوظائف ضروري لعمليات متعددة ، بما في ذلك بدء النسخ الأساسي وإصلاح تلف الحمض النووي عبر مسار إصلاح ختان النيوكليوتيدات (NER) [6،7]. ترتبط التعديلات في XPD التي تؤدي إلى خلل في وظيفة TFIIH بالاضطرابات متعددة الأنظمة والحساسة للأشعة فوق البنفسجية بما في ذلك جفاف الجلد المصطبغ (XP) و XP جنبًا إلى جنب مع متلازمة كوكايين (CS) وحثل trichothiodystrophy (TTD) [8 & # x0201310]. يتميز XP بشذوذ تصبغ ناتج عن الشمس وزيادة خطر الإصابة بسرطان الجلد بأكثر من 1000 مرة. يمكن أن تظهر الحالات الشديدة أيضًا مع تأخر في النمو وتنكس عصبي أولي [11]. من ناحية أخرى ، يعتبر CS و TTD من الاضطرابات progeroid القطاعية التي تتميز بفشل النمو التدريجي بعد الولادة وإزالة الميالين الأولية مما يؤدي إلى خلل وظيفي عصبي شديد ، ولكن بدون استعداد واضح للسرطان [12 & # x0201315]. المرضى الذين يعانون من مرض التصلب العصبي المتعدد يظهرون بالإضافة إلى ذلك الشعر والأظافر الهشة التي تعاني من نقص الكبريت وتقشر الجلد [13] ، الناتج عن عيب النسخ القاعدية في أنواع خلايا معينة [16 ، 17]. تم أيضًا وصف اضطراب مرتبط بالاستعداد للسرطان من XP بالإضافة إلى مضاعفات النمو العصبي لـ CS (XPCS) ، على الرغم من ندرتها ، [18].

عديدة XPD ترتبط الطفرات بنمط ظاهري حصري للمرض (على سبيل المثال ، XPD R722W مع TTD و XPD R683W مع XP) وبالتالي يُنظر إليها على أنها مسببة للمتلازمات المقابلة. تعتبر الأليلات غير المرتبطة حصريًا باضطراب واحد & # x0201clikely null & # x0201d alleles [19،20]. تفشل بعض هذه الأليلات في دعم قابلية البقاء في أحادي العدد شيزوساكارومايس بومب سلالة الخميرة مع طفرة فارغة في XPD متماثل راد 15 وبالتالي تعتبر خالية من النشاط البيولوجي المهم [19]. هذا التصنيف للأليلات إما مسببة أو خالية يحدد حاليًا ما نشير إليه بنموذج & # x0201cmonoallelic & # x0201d لـ XPD مرض. ومع ذلك ، فإن التعرف في السنوات الأخيرة على مرضى المجموعة D التكميلية من مجموعة XP الذين يعانون من عرض مرض غير نمطي ، بما في ذلك أعراض كل من XP و TTD [8] ، يلقي بظلال من الشك على قدرة مثل هذا النموذج أحادي الموازي لشرح التباين السريري في الزيجوت المتغاير المركب.

في السابق ، أنشأنا نموذجًا لفأر TTD (XPD R722W) يُظهر المتلازمة البشرية [15،21]. هنا نبلغ عن جيل متحولة إضافية Xpd الأليلات التي تفشل في دعم الجدوى من تلقاء نفسها ولكنها مع ذلك تخفف الشيخوخة القطاعية المبكرة المرتبطة بـ TTD ، والميزات الجلدية ، وقدرة إصلاح الحمض النووي الخلوي ، وبقاء الأشعة فوق البنفسجية عند وجودها في حالة متغايرة الزيجوت المركبة.


تقييم التقسيم الطبقي لمخاطر القلب والأوعية الدموية

يمثل فرط كوليسترول الدم العائلي 5٪ & # x0201310٪ من أمراض الشرايين التاجية في المرضى الذين تقل أعمارهم عن 55 عامًا .28 بدون علاج ، سيصاب 50٪ من الذكور غير المتجانسين بأمراض القلب التاجية قبل سن 50 و 100٪ بحلول سن 70 عامًا ، وحوالي 12٪ من الإناث المتغايرات الزيجوت سوف يصبن بأمراض الشرايين التاجية بعمر 50 عامًا ، ويزيد ذلك إلى 74٪ بحلول 70 عامًا .29 ومع ذلك ، فإن التعبير السريري عن أمراض الشرايين التاجية في مرضى FH متغاير الزيجوت غير متجانس للغاية من حيث عمر البداية والشدة. تميل أمراض القلب التاجية إلى التجمع مع تكرار أعلى في بعض العائلات ، ولكن يمكن أن تحدث اختلافات ملحوظة بين الأفراد ، 30 حتى بين الأشخاص القادمين من عائلات تشترك في نفس الطفرات في LDLR الجين ، مما يشير إلى أن العوامل الوراثية أو البيئية الأخرى تلعب دورًا مهمًا في تطور تصلب الشرايين في FH. 31 لذلك ، تم تحديد عدد من عوامل الخطر لـ FH ، من أجل تقسيم المخاطر إلى طبقات. إن تطبيق تقديرات المخاطر القياسية للكوليسترول يقلل بشكل خطير من خطر الإصابة بأمراض القلب التاجية في FH ، وبالتالي ، لا ينبغي استخدام درجة مخاطر Framingham في هذه الحالة. & # x02265 45 عامًا) تاريخ عائلي للمدخنين النشطين من أمراض الشرايين التاجية المبكرة (ذكر قريب من الدرجة الأولى & # x0003c 55 عامًا أو أنثى قريب من الدرجة الأولى & # x0003c 65 عامًا) LDL-C مرتفع جدًا (& # x0003e 330 مجم / ديسيلتر أو 8.5 ملي مول / لتر) منخفض HDL-C (& # x0003c 40 مجم / ديسيلتر أو 1.0 ملي مول / لتر) ارتفاع ضغط الدم (& # x0003e 140/90 ملم زئبق) داء السكري ، Lp (a) & # x0003e 60 مجم / ديسيلتر .20

يجب تقييم الأفراد الذين لا يعانون من أعراض مرض القلب الشرياني الشعاعي تحت الإكلينيكي بناءً على إثبات نقص تروية عضلة القلب من خلال اختبار الإجهاد (اختبار مخطط كهربية القلب أو تخطيط صدى القلب بالإجهاد أو اختبار نوكليد الراديو) أو إظهار لويحات تصلب الشرايين التاجية من خلال تصوير نضح عضلة القلب ، واكتشاف الكالسيوم التاجي عن طريق التصوير المقطعي المحوسب بشعاع الإلكترون ، أو التصوير المقطعي متعدد الشرائح (الحلزوني). يجب تقييم تصلب الشرايين تحت الإكلينيكي في مواقع أخرى من خلال مؤشر الكاحل والعضد غير الباضع ، والتثخين الوسيط السباتي الداخلي عن طريق التصوير فوق الصوتي ، والتصوير بالموجات فوق الصوتية في البطن للكشف عن تمدد الأوعية الدموية الأبهري.


ال C. ايليجانس الجينوم

C. ايليجانس كان أول كائن حي حقيقي النواة متعدد الخلايا يتم تسلسل جينومه (C. ايليجانس كونسورتيوم التسلسل 1998). كمعلومات تسلسل من إضافية التهاب الكينورهاب الأنواع وكذلك النيماتودا ذات الصلة البعيدة أصبحت متاحة في العقد الماضي ، المعلومات الواردة من C. ايليجانس قدم الأساس لدراسات الجينوميات المقارنة الثرية (Coghlan 2005). كله C. ايليجانس الجينوم 100 ميغا بايت (C. ايليجانس كونسورتيوم التسلسل 1998) ولديه 20444 جينًا لترميز البروتين (إصدار WormBase WS245 ، أكتوبر 2014). على حد سواء C. ايليجانس تحتوي الجنسين على خمسة كروموسومات جسمية تسمى مجموعة الربط (LG) I و II و III و IV و V والكروموسوم X. الجينات الفردية C. ايليجانس يتم ترتيبها بطريقة حقيقية النواة التقليدية مع 5 مناطق غير مترجمة ، وإطارات قراءة مفتوحة (ORFs) تحتوي على exons و introns ، و 3 مناطق غير مترجمة. مقارنة بجينات الفقاريات ، C. ايليجانس الجينات صغيرة نسبيًا بمتوسط ​​حجم جيني يبلغ 3 كيلو بايت ويرجع ذلك أساسًا إلى وجود إنترونات صغيرة جدًا (Spieth and Lawson 2006) C. ايليجانس تحتوي الجينات أيضًا على العديد من الإنترونات ذات الحجم الطبيعي). لا تحتوي الكروموسومات على السنتروميرات التقليدية أثناء الانقسام الفتيلي ، حيث يرتبط مغزل الأنبوب الدقيق بأكثر من موضع واحد على طول الكروموسوم (يُقال أن هذه المرفقات هي كل مركزية أو متعددة المراكز). في الواقع ، لا يبدو أن هناك حاجة إلى تسلسل محدد للتعلق لأن الجينات المحورة التي تحتوي على الحمض النووي خارج الصبغيات يمكن أن تُورث عبر العديد من الانقسامات الخلوية.

ال C. ايليجانس الجينوم له جانبان غير عاديين: معظم الرنا المرسال المشفر للبروتين عبر-تقسيم وبعض الجينات منظمة في الاوبرونات (بلومنتال 2005). عبر- الربط هو إضافة أحد تسلسلين من 22 نيوكليوتيد زعيم (SL1 و SL2) في نهاية 5 ′ من الرنا المرسال. يُعتقد أن تسلسل القائد يساعد في بدء الترجمة ، ولأن تسلسل SL1 / 2 معروف ، يمكن استخدامه تجريبيًا لتحديد التسلسل في نهاية 5 من mRNAs. بعض C. ايليجانس تتشكل mRNAs من نصوص متعددة الجينات مع تقسم أول mRNA إلى SL1 و mRNAs اللاحقة إلى SL2. الجينات التي ترمز لهذه النصوص متقاربة عن كثب جنبًا إلى جنب ويتم نسخها تحت سيطرة مروج واحد. تشبه هذه النسخ تلك التي تنتجها العوامل البكتيرية ورمز المنتجات الجينية التي يتم تكوينها معًا (Blumenthal 2005). ومع ذلك ، فإنها تختلف في أن النصوص المعالجة بتنسيق C. ايليجانس توليد عدة mRNAs. أشارت التجارب السابقة إلى أن الحمض النووي لا يتم ميثيله في C. ايليجانس، ولكن الدراسات الحديثة عالية الدقة أشارت إلى حدوث بعض المثيلة (Hu وآخرون. 2015). تمت دراسة جوانب تنظيم الجينات مثل النسخ والترجمة وإعادة تشكيل الكروماتين والتعديلات اللاحقة للنسخ (التواجد في كل مكان ، الفسفرة ، مثيلة الهيستون ، والجليكوزيل) باستخدام الأدوات الجينية لـ C. ايليجانس.


لم تذكر الدكتورة لويس سميث أي إفصاحات. تلقت السيدة كامير دعمًا بحثيًا من مؤسسة العلوم الوطنية. د. لم يبلغ غريفين وتشايلدز وسايدن عن أي إفصاحات. تلقى الدكتور تيتوف دعمًا بحثيًا من Tosteson و Fund for Medical Discovery. د. أبلغ داف وبايل وتايلور عن عدم وجود إفصاحات. تلقى الدكتور Yu-Wai-Man دعمًا بحثيًا من مجلس البحوث الطبية. د. لم يبلغ راميش وهورفاث عن أي إفصاحات. عمل الدكتور موثا في المجلس الاستشاري العلمي لشركة Raze Therapeutics ، وكان مستشارًا لـ Raze Therapeutics ، وقد حصل على شرف المتحدثين من الكليات الأكاديمية والجامعات والمستشفيات وتلقى دعمًا بحثيًا من المعاهد الوطنية للصحة ومعهد هوارد هيوز الطبي. عمل الدكتور تشينري في هيئة تحرير مجلة مخ وحصل على دعم بحثي من مجلس البحوث الطبية و Wellcome Trust. انتقل إلى Neurology.org/ng للحصول على نماذج الإفصاح الكامل.

بي اف سي هو زميل أول في ويلكوم ترست في العلوم السريرية (101876 / Z / 13 / Z) ومحقق أول في المعهد الوطني لحقوق الإنسان في المملكة المتحدة يتلقى الدعم من وحدة بيولوجيا الميتوكوندريا التابعة لمجلس البحوث الطبية (MC_UP_1501 / 2) ، ومركز ويلكوم ترست لأبحاث الميتوكوندريا (096919Z) / 11 / Z) ، ومجلس البحوث الطبية (المملكة المتحدة) ومركز أبحاث أمراض العضلات الانتقالية (G0601943) ، والاتحاد الأوروبي FP7 TIRCON ، والمعهد الوطني للبحوث الصحية (NIHR) ومركز البحوث الطبية الحيوية ومقره في مستشفيات جامعة كامبريدج NHS Foundation Trust و جامعة كامبريدج. ر. بتمويل من Wellcome Trust Centre for Mitochondrial Research (096919Z / 11 / Z) ، ومجلس البحوث الطبية (المملكة المتحدة) ومركز أبحاث أمراض العضلات المتعدية (G0601943) ، ومؤسسة Lily ، و NHS البريطانية المتخصصة للغاية "اضطرابات الميتوكوندريا النادرة في خدمة الكبار والأطفال في نيوكاسل أبون تاين. P.Y.-W-M. هو عالم طبي في مجلس البحوث الطبية (MRC ، المملكة المتحدة) (G1002570). P.Y.-W-M. يتلقى أيضًا تمويلًا من Fight for Sight (المملكة المتحدة) والمعهد الوطني البريطاني للبحوث الصحية (NIHR) كجزء من التعاون البحثي الانتقالي للأمراض النادرة. في. محقق في معهد هوارد هيوز الطبي. الآراء المعبر عنها هي آراء المؤلف (المؤلفين) وليست بالضرورة آراء NHS أو NIHR أو وزارة الصحة.


أنشطة

فيما يلي قائمة موجزة بمفردات علم الوراثة و ذبابة الفاكهة التدوين المستخدم في هذا النشاط.

الجين وحدة معلومات وراثية تتكون من DNA.

أليل أحد الأشكال البديلة للجين.

النمط الظاهري سمات الكائن الحي التي يتم التعبير عنها.

الطراز العرقى التركيب الجيني للكائن الحي.

متماثل وجود أليلين متطابقين لسمة معينة.

متغاير الزيجوت وجود أليلين مختلفين لسمة معينة.

الأليل السائد في حالة متغايرة الزيجوت ، الأليل الذي يتم التعبير عنه.

أليل متنحي في حالة متغايرة الزيجوت ، الأليل غير المعبر عنه.

النوع البري الفرد الذي لديه النمط الظاهري الطبيعي أي النمط الظاهري الموجود بشكل عام في مجموعة طبيعية من الكائنات الحية.

متحولة الفرد الذي له صفة ظاهرية تختلف عن النمط الظاهري العادي.

  • يتم تحديد النوع البري بعلامة "+" لأي أليل.
  • يتم تحديد الطفرات بواسطة حرف أو أحرف تتعلق بالنمط الظاهري للطفرة.
  • تتم كتابة الطفرات الموروثة بشكل متنحي بأحرف صغيرة.
  • يتم رسملة الطفرات الموروثة بشكل مهيمن.
  • تتم كتابة الطفرات المرتبطة بـ X على هيئة نصوص فوقية لكروموسومات X (على سبيل المثال ، X w). يتم أيضًا سرد كروموسومات Y للذكور.
  • يسرد النمط الجيني المكتوب الأليلين المفصولين بشرطة مائلة (على سبيل المثال ، + /vg).
  • الجينات الوراثية
  • علم الأحياء التنموي
  • مشاكل صحة الإنسان (مثل إدمان الكحول)

  1. اطلب من الطلاب فتح صفحات الطلاب على أجهزة الكمبيوتر الخاصة بهم ، أو توزيع نسخ ورقية.
  2. قم بإسقاط صورة ذبابين من النوع البري (الصورة "أ").
    • اطلب من الطلاب قراءة النص والإجابة على الأسئلة المتعلقة بالذباب البري.
    • قُد مناقشة حول ما لاحظوه ، ثم قدم فكرة النمط الظاهري.
    • هنئ أي طالب أدرك أن الذباب ذكور وإناث. أخبرهم أن الذبابة ذات الصبغة الأغمق في طرف بطنها هي الذكر.
  3. صورة المشروع "B" ، ذبابة من النوع البري مقترنة بطفرة أثرية. (لا تخبرهم باسم الذبابة الطافرة حتى يدونوا ملاحظاتهم.)
    • اطلب من الطلاب مقارنة الذبابين وملء أعمدة الوصف في جدولهم.
    • أخبر الطلاب أن النمط الظاهري لهذه الذبابة "أثرية" بسبب جناحيها القصير ، ودعهم يسجلون ذلك.
  4. كرر # 3 مع كل من مجموعات الذباب المتبقية.

ملاحظة: الذبابة الطافرة النهائية ، العيون البيضاء ، هي نمط ظاهري يسهل رؤيته ، لكن نمط الوراثة (المرتبط بـ X) يستخدم بشكل أفضل مع الطلاب المتقدمين. للحصول على درس تمهيدي ، قد ترغب في تخطي هذه الذبابة.

  • ذكر الطلاب أنه مع وجود طفرة سائدة ، يمكن للفرد أن يكون لديه نمطين وراثيين محتملين.
  • إذا قمت بتضمين الذبابة بيضاء العينين ، فسيحتاج الطلاب إلى تعريفهم بمفهوم الخصائص المرتبطة بالجنس ، ويجب أن يأخذوا في الاعتبار النمط الوراثي لكل من الذباب من الذكور والإناث.

منذ ما يقرب من 100 عام ، كانت ذبابة الفاكهة ذبابة الفاكهة سوداء البطن لعب دورًا محوريًا في أبحاث علم الوراثة والبيولوجيا الجزيئية. في هذا النشاط ، اخترنا طفرات ذبابة ذات اختلافات يمكن رؤيتها بسهولة واستخدمناها كنقطة انطلاق لمساعدة الطلاب على التعرف على النمط الظاهري ، والنمط الجيني ، وأنماط الوراثة الجينية.

ذكور وإناث الذباب البري
يختلف الذكر والأنثى إلى حد ما في المظهر. أحد الاختلافات التي يمكن ملاحظتها بسهولة في الصور المجهرية هو أن لون الذكور أكثر قتامة عند طرف بطنه. (الاختلافات الأخرى هي أن طرف بطن الذكر مستدير بينما تكون الأنثى مدببة ، والذكور لديهم "أمشاط جنسية" ، وهي مناطق ذات شعيرات داكنة على أرجلهم الأمامية لا تمتلكها الإناث. ولكن من الصعب ملاحظة هذه الاختلافات في الصور.)

النمط الظاهري والنمط الجيني
النمط الظاهري، السمة الجسدية ، يتم تحديدها بواسطة الطراز العرقى، أو التركيب الجيني للكائن الحي. يتم تحديد سمات الجين الواحد بواسطة أليلين ، أحدهما موروث من الأم والآخر من الأب. النمط الظاهري هو وصف ، في حين أن التركيب الوراثي هو ، في هذه الحالة ، زوج من الأليلات حيث قد يكون كل أليل متماثل (متماثل اللواقح ، على سبيل المثال ، + / + ، vg / vg) ، أو مختلفة (متغايرة الزيجوت ، على سبيل المثال ، + / vg Cy / +).

أنماط الميراث
عندما تكون هناك حاجة لنسختين من نفس الأليل للتعبير عن نمط ظاهري معين ، فإننا نقول إن نمط الوراثة لتلك السمة هو الصفة الوراثية النادرة. على سبيل المثال ، يتم توريث النمط الظاهري الأثري بشكل متنحي. يجب أن يكون النمط الجيني للذبابة الأثرية vg / vg. المتحولات المتنحية الأخرى في هذا النشاط هي بلا عيون وخشب الأبنوس. مثال على سمة بشرية من المحتمل أن تكون موروثة بطريقة متنحية هي تلك الخاصة بقمة الأرملة (خط شعر الشخص يصل إلى نقطة في الجزء العلوي من الجبهة). عندما يتطلب الأمر أليلًا واحدًا فقط للتعبير عن سمة ، كما هو الحال مع الطفرة ذات الأجنحة المجعدة ، فإن نمط الوراثة الخاص بها يكون مهيمن. يمكن أن يكون النمط الجيني للذبابة مجعدة الأجنحة ساي/ + أو ساي/جذ. مثال على سمة موروثة بشكل سائد في البشر هي حالة الودانة ، وهي شكل من أشكال التقزم.

النمط الجيني لذبابة من النوع البري
عندما نلاحظ ذبابة من النوع البري في المظهر ، ونفكر في التركيب الوراثي لها ، فإننا لا نعرف حقًا ما إذا كانت متماثلة اللواقح أو متغايرة الزيجوت لطفرة متنحية. قد يحمل أليلًا واحدًا من النوع البري ، على سبيل المثال ، للون الجسم ، وأليل متنحي ، على سبيل المثال ، أليل خشب الأبنوس. نظرًا لأن خشب الأبنوس موروث بشكل متنحي ، فإننا نعلم أن الذبابة البرية يجب أن تحتوي على أليل واحد على الأقل من النوع البري للون الجسم. يمكننا اكتشاف التركيب الوراثي لها عن طريق إجراء تهجين جيني مع زيجوت متماثل متنحي ، في هذا المثال ، ذبابة الأبنوس. تمت تغطية هذه الفكرة في نشاط "الصلبان الجينية".

الطفرات المرتبطة بالكروموسوم X
كانت طفرة العين البيضاء أول طفرة ذبابة يتم اكتشافها. إنه ل مرتبط بـ X، أو مرتبط بالجنس، طفره. كما هو الحال في البشر ، فإن الذباب الذي يحمل اثنين من الكروموسومات X يكون من الإناث والذباب الذي يحمل واحدًا X وواحد Y يكون من الذكور. في ذبابة الفاكهة ، يختلف كروموسوم Y هيكليًا عن كروموسوم X ، ولا يحمل جينات مكملة لتلك الموجودة على X ، لذلك سيتم التعبير عن أي جين موجود على X في الذكر ، في حين أن القواعد العادية من الوراثة السائدة والمتنحية تنطبق على إناث الذباب لأنها تحمل اثنين من الكروموسومات X. يجب أن يكون لدى الرجل ذو العين البيضاء الطفرة البيضاء على كروموسوم X المفرد. في أنثى الذبابة ، يتم توريث الطفرة البيضاء بشكل متنحي ، لذا فإن نسختين من الطفرة البيضاء ضرورية لإنتاج أنثى ذات عين بيضاء.

بدعم من أ جائزة شراكة تعليم العلوم (SEPA) من المركز الوطني لمصادر البحث والمعاهد الوطنية للصحة، و ال مؤسسة ديفيد ولوسيل باكارد.


تمدد عضلة القلب في الفئران المتحولة بروتين سي المرتبط بالميوسين

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

اعثر على مقالات بواسطة McConnell، B. في: JCI | PubMed | منحة جوجل

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات مع: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات مع: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات مع: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

اعثر على مقالات بواسطة Aristizabal، O. في: JCI | PubMed | منحة جوجل

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

اعثر على مقالات بواسطة Turnbull، D. في: JCI | PubMed | منحة جوجل

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

اعثر على مقالات بواسطة Georgakopoulos، D. في: JCI | PubMed | منحة جوجل

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

اعثر على مقالات بواسطة Niimura، H. في: JCI | PubMed | منحة جوجل

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

اعثر على مقالات بواسطة Fischman، D. في: JCI | PubMed | منحة جوجل

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

اعثر على مقالات بواسطة Seidman، C. في: JCI | PubMed | منحة جوجل

1 قسم الوراثة ، معهد هوارد هيوز الطبي وكلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 2 قسم القلب والأوعية الدموية ومعهد هوارد هيوز الطبي ، مستشفى بريجهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 3 قسم القلب والأوعية الدموية ، قسم الطب ، بريغهام و مستشفى النساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 4 معهد Skirball للطب الجزيئي الحيوي ، كلية الطب بجامعة نيويورك ، نيويورك ، نيويورك 10016 ، الولايات المتحدة الأمريكية 5 قسم أمراض القلب ، معهد جونز هوبكنز الطبي ، بالتيمور ، ماريلاند 21287 ، الولايات المتحدة الأمريكية 6 قسم قسم أمراض القلب الجزيئي ، معهد أبحاث ليرنر ، مؤسسة كليفلاند كلينيك ، كليفلاند ، أوهايو 44195 ، الولايات المتحدة الأمريكية 7 قسم علم الأمراض ، مستشفى بريغهام والنساء ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية 8 قسم بيولوجيا الخلية ، كلية طب وايل بجامعة كورنيل ، نيويورك ، نيويورك 10021 ، الولايات المتحدة الأمريكية

عنوان المراسلات إلى: جوناثان سيدمان ، قسم علم الوراثة ، كلية الطب بجامعة هارفارد ، 200 لونغوود أفينيو ، مبنى ألبرت ، بوسطن ، ماساتشوستس 02115 ، الولايات المتحدة الأمريكية. الهاتف: (617) 432-7871 الفاكس: (617) 432-7832 البريد الإلكتروني: [email protected]

اعثر على مقالات بواسطة Seidman، J. في: JCI | PubMed | منحة جوجل

تم النشر في 1 نوفمبر 1999 - مزيد من المعلومات

لتوضيح دور بروتين سي المرتبط بالميوسين القلبي (MyBP-C) في بنية ووظيفة عضلة القلب ، قمنا بإنتاج الفئران التي تعبر عن أشكال متغيرة من هذا البروتين القسيمي. تشفر الطفرات المهندسة أشكالًا مبتورة من MyBP-C حيث تم استبدال مجال ربط سلسلة الميوسين القلبي الثقيل ومجال ربط titin بمخلفات الأحماض الأمينية الجديدة. تسبب العيوب متغايرة الزيجوت في البشر اعتلال عضلة القلب الضخامي. تعبر الفئران المتماثلة اللواقح لأليلات MyBP-C الطافرة عن أقل من 10٪ من البروتين المقطوع في النطاقات M من الأورام اللحمية الطبيعية. الفئران متجانسة الزيجوت التي تحمل أليلات MyBP-C الطافرة قابلة للحياة ولكنها تظهر بداية حديثي الولادة من اعتلال عضلة القلب المتوسع التدريجي مع التشريح المرضي البارز لتضخم الخلايا العضلية ، والاضطراب العضلي الليفي ، والتليف ، والتكلس الضار. أظهر تخطيط صدى القلب للفئران الطافرة متماثلة اللواقح تمدد البطين الأيسر وانخفاض وظيفة انقباض عند الولادة تضخم عضلة القلب مع نضوج الحيوانات. أظهرت تحليلات حجم ضغط البطين الأيسر في الفئران الطافرة متماثلة اللواقح البالغة انخفاضًا في انقباض الانقباض مع اختلال وظيفي انبساطي. تراجع هذه البيانات فهمنا للدور الذي يلعبه MyBP-C في تكوين الليف العضلي أثناء نمو القلب وتشير إلى أهمية هذا البروتين لوظيفة قسيم عضلي طويل الأمد والتشكيل القلبي الطبيعي. نقترح أيضًا أن الفئران التي تحمل طفرات متماثلة في عضلة القلب الضخامي العائلي متماثل الزيجوت - قد توفر أدوات مفيدة للتنبؤ بشدة المرض الذي ستسببه هذه الطفرات في البشر.

اعتلالات عضلة القلب الضخامية والمتوسعة هي أمراض مهمة تزيد من كتلة عضلة القلب ، وإن كان ذلك مع أنماط مميزة لإعادة التشكيل (راجع المراجع 1 ، 2). ينتج اعتلال عضلة القلب الضخامي سماكة جدار البطين دون زيادة في حجم البطين ، بينما يزيد كل من سمك الجدار وحجم الغرفة في اعتلال عضلة القلب التوسعي. تميز المعلمات الانقباضية أيضًا بين هذه الأمراض ، مع الحفاظ على الوظيفة الانقباضية أو تحسينها في القلوب الضخامية ولكنها تتضاءل في اعتلال عضلة القلب التوسعي. في حين أن الأحداث المسببة لكل من هذه الأمراض تبدو مختلفة عادةً ، فإن الملاحظات السريرية تشير إلى تداخل محتمل في الإشارات الجزيئية و / أو الأحداث الخلوية التي تعيد تشكيل القلب ، لأن بعض المرضى الذين يعانون من اعتلال عضلة القلب الضخامي يطورون نمطًا ظاهريًا متوسعًا.

تمثل الطفرات في بروتين سي المرتبط بالميوسين القلبي (MyBP-C) حوالي 20٪ من اعتلال عضلة القلب الضخامي العائلي (FHC) (3-7). في حين أن طفرات بروتينات قسيم عضلي أخرى التي تشارك في توليد القوة من المتوقع أن تسبب FHC من خلال تأثير سلبي مهيمن على الخصائص الانقباضية ، فإن الآلية (الآليات) التي تسبب بها عيوب MyBP-C القلبية تسبب FHC أقل تأكيدًا (تمت مراجعتها في المراجع 8 ، 9) ). MyBP-C هو بروتين عضلي ليفي كبير وفير له وظائف هيكلية وتنظيمية (10). أثناء تطور القلب ، يتوافق تعبير MyBP-C مع بداية تكوين الليف العضلي ، ويُعتقد أن 3 أشكال شبيهة بالفيبرونيكتين ضرورية لتجميع الخيوط السميكة. في القلب الناضج ، تم العثور على MyBP-C في 7-9 شرائط عرضية (متباعدة حوالي 43 نانومتر) تقع في المنطقة C من الساركومير العصابات A (11-13). في حين أن MyBP-C لا يشارك بشكل مباشر في توليد القوة ، فإن الفسفرة العكسية بواسطة بروتين كيناز A المعتمد على cAMP والبروتين كيناز 2 المعتمد على الكالسيوم / كالودولين (15) قد يؤثران على وظيفة الانقباض عن طريق تحفيز الأكتوموسين القلبي ATPase (16) أو التأثير توليد التوتر الليفي العضلي والسرعة الانقباضية (17). تم وصف ستة طفرات MyBP-C المسببة لـ FHC والتي من المتوقع أن تقوم بتشفير polypeptides المقطوعة (3-5) التي تفتقر إلى بقايا الكربوكسيل المطلوبة لربط سلسلة الميوسين الثقيلة والتيتين والتي لها بقايا جديدة في نهاية الكربوكسيل الخاصة بهم. FHC هي سمة جسمية سائدة ، والأفراد المصابون متغاير الزيجوت لهذه الطفرات. الأفراد الذين يحملون هذه الطفرات الستة المسببة لـ FHC لديهم أشكال مشابهة من FHC. الآلية التي تسبب بها طفرات MyBP-C المسببة للاضطراب في هيكل القلب ووظيفته غير معروفة ، لأنه لم يتم العثور على الببتيدات الطافرة ولا المستويات المنخفضة من MyBP-C في أنسجة القلب من المرضى المصابين (18).

لقد أنشأنا فئرانًا تحمل جين MyBP-C القلبي المتغير طفريًا والذي يشفر ببتيدًا مبتورًا ، مشابهًا لذلك الموجود في اعتلال عضلة القلب الضخامي البشري. على الرغم من أن مرضى FHC متغاير الزيجوت ، ويحملون أليلًا متحورًا واحدًا و 1 أليل MyBP-C من النوع البري ، فقد قمنا بتربية الفئران التي تحمل أليلات MyBP-C المتحولة إلى تماثل الزيجوت بحيث تحمل فقط أليلات MyBP-C المتحولة. لا يمكن التعبير عن بروتين MyBP-C الطبيعي في أنسجة القلب لهذه الفئران ، وتم العثور على الببتيدات MyBP-C الطافرة بمستويات منخفضة بشكل ملحوظ. افترضنا أن الفئران المتماثلة اللواقح التي تحمل أليلات MyBP-C الطافرة قد يكون لها نمط ظاهري قلبي مختلف عن الفئران متغايرة الزيجوت التي تحمل أليلًا متحورًا واحدًا وأليلًا من النوع البري واحدًا. لقد درسنا بنية القلب ووظيفة الفئران المتحولة متماثلة اللواقح لتحديد الآليات التي تغير بها طفرات MyBP-C المسببة لـ FHC فسيولوجيا القلب.

جيل من الفئران متماثلة اللواقح القلبية MyBP-C. تم تضخيم متواليات Murine MyBP-C من الحمض النووي الريبي القلبي بواسطة RT-PCR باستخدام بادئات قليلة النوكليوتيد 3301F و 3900 R مشتقة من الإنسان المنشور. MYBPC3 تسلسل الجينات (رقم انضمام EMBL X84075) ويستخدم لفحص مكتبة الجينوم الفرعي 129SvJ (غير منشورة). تم عزل استنساخ العاثيات ، λMyBPc ، الذي يحتوي على جين الفئران MyBP-C ، والذي منه 7.4 كيلو بايت Speتم استنساخ الجزء الأول في pBluescript وتميز بتحليل تسلسل النوكليوتيدات الجزئي. تم استنتاج حدود Intron-exon بالمقارنة مع الجين البشري (الشكل 1 أ). جزء غير حاد ، 2 كيلو بايت يشفر جين النيوميسين المحاط بـ LoxP تم استئصال تسلسل من البلازميد pPTloxPNeo (تم توفيره من قِبل J. Rossant) ، وتم إدراجه في ملف سابقة بمعنى البيئةموقع RV داخل exon 30.

رسم تخطيطي لـ (أ) التركيب الجيني لـ البرية من النوع MyBP-C, MyBP-C (LoxP)، و MyBP-C (نيو) الأليلات ، RNAs التي ينتجها كل أليل ، و (ب) بنية بروتينات MyBP-C المشفرة بواسطة كل أليل. (أ) يتم عرض Exons 29-32 من الجين MyBP-C القلبية الفأرية لكل أليل (انظر الطرق). الطفرات تغير فقط exon 30 جميع exons الأخرى متطابقة. تعكس الخطوط السوداء الموجودة فوق كل جزء جيني بنية الحمض النووي الريبي المشفر المشار إليه في الخطوط السميكة 5 ′ → 3 وهي عبارة عن exons مدمجة في RNA ، وتشير الخطوط الرفيعة إلى تخطي أجزاء من الجين غير موجود في RNA. تم تحديد الأنماط الجينية للفئران باستخدام البادئات 1F ، 1R ، 2F ​​، 2R ، و 3R. تم استخدام الاشعال 4F و 4R لتحديد بنية MyBP-C RNAs من الحمض النووي الريبي المستنتج موضحة فوق كل أليل. (ب) هيكل نهايات الكربوكسيل لعديد الببتيدات MyBP-C المشفر بواسطة MyBP-C (نيو) و MyBP-C (Lox) تم استنتاج الأليلات من تسلسل الحمض النووي الريبي الموجود في البطين الأيسر لفئران متماثلة اللواقح تحمل الأليل المشار إليه. يتم ترميز المخلفات (بين البقايا 1064 و 1111) من البروتين من النوع البري بواسطة exon 30. يتم تشفير بقايا الأحماض الأمينية الجديدة في نهاية الكربوكسيل للبروتينات الطافرة (غامقة) عن طريق القراءة المعدلة لـ exon 30 (Lox) أو exon 31 (نيو). بروتين MyBP-C من النوع البري هو 1270 من الأحماض الأمينية بينما بروتين MyBP-C (Lox) هو 1240 من الأحماض الأمينية ، ولا تظهر التسلسلات الكاملة لهذين النهايتين الكربوكسيل. يتم عرض نهاية الكربوكسيل للطفرة البشرية المماثلة الموجودة في العائلة NN (3) للمقارنة. تعكس الاختلافات بين بروتين العائلة NN وبروتين MyBP-C (Neo) اختلافات التسلسل بين الماوس وجين MyBP-C البشري exon 31.

تم إدخال بنية الاستهداف في الخلايا الجذعية الجنينية (ES) واختيارها (19). تم فحص المستعمرات من أجل إعادة التركيب المتماثل بواسطة تحليلات اللطخة الجنوبية باستخدام مسبار خارجي (البيانات غير معروضة). تم حقن الخلايا الجذعية الجنينية المستهدفة في الكيسات الأريمية للفأر كما هو موصوف (20). تم التحقق من الأنماط الجينية من الحمض النووي الذيل في نسل الحيوانات الخيمرية عن طريق تحليلات PCR (مقايسة 25 ميكرولتر) باستخدام الاشعال (الشكل 1 أ) لتضخيم exon 30: 1F (CTAGGTACTAACAG GCTCCTGCTT) ، 1R (CCTACCATGCAGGAAACCAGAATA) والبادئات: 2F (GCAGT) 2R (GTAGCCGATCAAGCGTATG) لتضخيم شريط النيومايسين المُدرج.

بالإضافة إلى ذلك ، تم تزاوج فأر خيمري ذكر مع فأر معدّل وراثيًا EIIa-Cre (تم توفيره من قِبل H. LoxPمحاط نيو تم حذف الجين بكفاءة (الشكل 1 أ). تم تحديد النمط الجيني MyBP-C (Lox) عن طريق تحليلات PCR لـ exon 30 وغياب تسلسل Neo. الفئران متماثلة اللواقح ل MyBP-C (نيو) أو MyBP-C (Lox) تم إنتاج الأليلات (كلاهما المعين MyBP-C t / t) عن طريق تربية الحيوانات غير المتجانسة.

تحليلات الحمض النووي الريبي تم عزل إجمالي الحمض النووي الريبي من البطين الأيسر (LV) ، والبطين الأيمن (RV) ، والأذين ، باستخدام Trizol (GIBCO BRL Life Technologies ، فريدريك ، ماريلاند ، الولايات المتحدة الأمريكية) وتم تحليله بواسطة إجراءات اللطخة الشمالية القياسية (22). تم الكشف عن MyBP-C RNA باستخدام إدراج 32 P-Label من استنساخ الماوس cDNA المعين pcMyBPC ، والذي يشفر بقايا الأحماض الأمينية MyBP-C 582-1110. تم الكشف عن RNAs أخرى باستخدام تحقيقات oligonucleotide الخاصة بنسخ 5′ - 32 P مع ظروف التهجين القياسية (23) على النحو التالي: α-skeletal actin: 5′-TGGCTTTAATGCTTCAAGTTTT CATTTCCTTTCCACAGGG الببتيد الناتريوتريك للدماغ (BNPGTAGTAGCCTAG): Ca 2+ -ATPase (SERCA): 5′-AACAACGCACATGCACGCACCCGAACAC CTT-ATATTTCTGCAAATGG GAPDH: 5′-GGAA-CATGTAGA-CCATGTAGTGAGGTCAATGAAG. تم قياس إشارات التهجين باستخدام برنامج ImageQuant (الديناميكيات الجزيئية ، Sunnyvale ، كاليفورنيا ، الولايات المتحدة الأمريكية) ، وتم تطبيعها مع شدة الإشارة التي لوحظت باستخدام قليل النوكليوتيد الخاص بـ GAPDH RNA. تلاميذ ر تم إجراء الاختبارات لتحديد ما إذا كانت البيانات تختلف اختلافًا كبيرًا بين مجموعات الفئران.

تم تقييم بنية MyBP-C RNA عن طريق تحليل تسلسل النيوكليوتيدات لشظايا الحمض النووي المضخم لـ RT-PCR باستخدام الظروف الموصوفة سابقًا (3) باستخدام البادئات 4F (TCAGGTGACCTGACCAAAGAG) و 4 R (ATGTTATGGCTGAAGACCCGG).

تحليلات البروتين. تم عزل أنسجة القلب ، وغسلها في PBS من Dulbecco ، وتم تنظيفها على ورق ترشيح ، وتم تجانسها في محلول مثبط للثلج (24) يحتوي على 50 ملي مولار من فوسفات ثنائي هيدروجين البوتاسيوم (KH2ص4) ، 70 ملي فلوريد الصوديوم (NaF) ، و 5 ملي EDTA ، مع مثبطات الأنزيم البروتيني (5 ميكروغرام / مل مضاد للألم ، 10 ميكروغرام / مل ليوببتين ، 5 ميكروغرام / مل بيبستاتين A ، 43 ميكروغرام / مل PMSF ، 5 ملي مولار EGTA ، و 0.1 μM orthovanadate الصوديوم). تم عزل كسور اللييفات العضلية من متجانسات البروتين الكلي بالطرد المركزي عند 15000 ز لمدة 5 دقائق عند 4 درجات مئوية. تم إعادة تعليق الحبيبات في تثبيط المخزن المؤقت بالإضافة إلى 1 ٪ Triton X-100. تم طرد اللييفات العضلية المستخلصة بالمنظفات مرة أخرى عند 5000 ز لمدة 5 دقائق ، وأعيد تعليق بيليه في العازلة تثبيط.

تم فصل أجزاء البروتين بالطرق القياسية على 6٪ بولي أكريلاميد هلام صغير (تحليلات لطخة غربية) ، 6٪ جل بلاطة بولي أكريلاميد (شكل قلبي α- و β- ميوسين ثقيل السلسلة [MHC] المرجع 25) ، أو 12٪ جل لوح بولي أكريلاميد ( مجموع البروتينات). تم تحديد تركيز البروتين باستخدام اختبار برادفورد للبروتين. تم قياس نسبة α- و β-MHC القلبية عن طريق قياس الكثافة وبرنامج NIH-Image (المعاهد الوطنية للصحة ، بيثيسدا ، ماريلاند ، الولايات المتحدة الأمريكية).

تم تحديد MyBP-C من خلال تحليلات اللطخة الغربية (Amersham Pharmacia Biotech UK ، Little Chalfont ، Buckinghamshire ، إنجلترا ، المرجع 26) من إجمالي البروتين أو متجانسات اللييفات العضلية المفصولة بواسطة مواد هلامية SDS-PAGE (125 فولت لمدة ساعتين) ، تم نقلها إلى أغشية النيتروسليلوز (35 فولت لمدة 2.5 ساعة) ، وحضنت مع عضلات هيكل عظمي مضادة للدجاج الأرنب MyBP-C γ- مصل الجسم المضاد متعدد النسيلة (مخفف 1: 10000 المرجع 27). تم الكشف عن البروتينات التي تحمل علامات الأجسام المضادة باستخدام مجموعة التلألؤ الكيميائي المحسن (ECL + Plus Amersham Life Sciences Inc.). تم قياس الكميات النسبية من البروتين المسمى بالأجسام المضادة عن طريق قياس الكثافة وبرنامج NIH-Image.

علم الصرف والميكروسكوب. تم التضحية بالحيوانات عن طريق خلع عنق الرحم وتم استئصال القلوب وشطفها في PBS (GIBCO) ووزنها. تم عزل أنسجة القلب كما هو موصوف (28) وأجريت التقييمات المرضية من قبل أخصائي أمراض القلب من ذوي الخبرة.

تم تركيب الأنسجة المستأصلة في كتل البارافين كما هو موصوف (25) وتم تلطيخ الأجزاء 3-7 ميكرومتر بهيماتوكسيلين ويوزين (H & ampE) أو ماسون ثلاثي الكروم (American HistoLabs Inc. Gaithersburg ، ميريلاند ، الولايات المتحدة الأمريكية). تم الحصول على صور عالية التكبير باستخدام مجهر ضوئي Zeiss Axiophot (Carl Zeiss Inc. ، Thornwood ، نيويورك ، الولايات المتحدة الأمريكية) مجهز بهدف غمر بالزيت × 2.5 و × 20 و × 40 وكاميرا صور رقمية من سوني (DKC-5000) شركة سوني ، طوكيو ، اليابان).تم عرض الصور باستخدام برنامج Adobe Illustrator (Adobe Systems Inc. ، ماونتن فيو ، كاليفورنيا ، الولايات المتحدة الأمريكية).

تم تحضير أقسام LV و RV للفحص المجهري الإلكتروني للإرسال كما هو موضح سابقًا (29). باختصار ، تم إصلاح المقاطع بـ 2.5 ٪ جلوتارالدهيد + 2 ٪ بارافورمالدهيد في محلول كاكوديلات 0.1 ميكرومتر ، ودرجة الحموضة 7.4 ، ثم شطفها 3 مرات في محلول كاكوديلات 0.1 ميكرومتر ، ودرجة الحموضة 7.4 ، وثابتة لاحقًا في 1 ٪ رابع أكسيد الأوزميوم (OsO)4) لمدة ساعتين ، تشطف في درهم20 ، ثم 1٪ أسيتات اليورانيل لمدة ساعة واحدة (تلطيخ en-block). تم تجفيف الكريات الثابتة في الكحول ، وشطفها مرتين في أكسيد البروبيلين لمدة 20 دقيقة ، ودمجها طوال الليل بنسبة 1: 1 من أكسيد البروبيلين إلى محلول راتنج Spurr. بعد 12 ساعة ، تم استبدال هذا المحلول بمحلول سبور 100٪ ثم بلمرته في فرن جاف عند 70 درجة مئوية لمدة 48 ساعة. لوحظت أقسام رقيقة للغاية (بسمك 100 نانومتر) من العينات الملطخة والمدمجة في وضع الإرسال باستخدام مجهر إلكتروني فيليبس CM12 (FEICompany ، //www.feic.com).

تقييم وظيفة الجهد المنخفض. تم إجراء تخطيط صدى القلب عبر الصدر في الفئران بعمر 0 ​​إلى 3 أيام باستخدام تقنية تخطيط صدى القلب عالية التردد (45 ميجاهرتز) (25). تم إجراء تصوير تخطيط صدى القلب بدون تخدير ومع الفئران مقيدة قليلاً في وضع ضعيف باستخدام جهاز Humphrey Ultrasound Biomicroscope (طراز 840 Humphrey Instruments ، سان لياندرو ، كاليفورنيا ، الولايات المتحدة الأمريكية). تم الحصول على معلمات LV من صور تخطيط صدى القلب ثنائية الأبعاد في عرض المحور القصير. تم تحديد معدلات ضربات قلب الفأر حديثي الولادة من تتبع دوبلر المستمر باستخدام نظام دوبلر عالي التردد (25 ، 30).

تم إجراء تخطيط صدى القلب عبر الصدر في الفئران البالغة (GT 3 أسابيع) باستخدام سونوس 5500 بالموجات فوق الصوتية مع محول 12 ميجا هرتز (هيوليت باكارد ، أندوفر ، ماساتشوستس ، الولايات المتحدة الأمريكية). تم تخدير الفئران باستخدام 2.5٪ Avertin (0.010 مل / جم) وتم تسخينها باستخدام وسادة تدفئة أثناء فحص تخطيط صدى القلب. تم الحصول على صور تخطيط صدى القلب ثنائية الأبعاد مع الفئران الموجهة في استلقاء جانبي يسار أو وضع ضعيف. تم الحصول على معلمات LV من استجواب الوضع M في عرض المحور القصير. تم الحصول على قطر الأذين الأيسر المتعامد (LAD) من صور تخطيط صدى القلب ثنائية الأبعاد في عرض المحور الطويل. تم حساب متوسط ​​قياسات تخطيط صدى القلب ، لكل من دراسات الفئران حديثي الولادة والكبار ، من 3 دورات قلبية منفصلة على الأقل: سمك الجدار الأمامي LV (LVAW) ، سمك الجدار الخلفي LV (LVPW) ، القطر الانبساطي LV الأقصى (LVDD) ، القطر الانقباضي الأدنى LV ( LVSD) ، تقصير LV الجزئي (LVFS) ، أقصى LAD ، ومعدل ضربات القلب. تم تحديد الدلالة الإحصائية للاختلافات في معلمات تخطيط صدى القلب بين الفئران من النوع البري وفئران MyBP-C بواسطة Student's غير المزاوجة ر-اختبار. يتم التعبير عن البيانات على أنها تعني ± SD. أ ص تم اعتبار القيمة الأقل من 0.05 مهمة.

تم إجراء تحليل للخصائص الانقباضية والانبساطية لغرفة LV في الجسم الحي كما هو موصوف (31). باختصار ، تم استخدام قسطرة مقاومة / ميكرومومتر مصغر لاشتقاق علاقات الضغط والحجم في الوقت الحقيقي. تم تخدير الحيوانات بالإيتوميديت (10-20 مجم / كجم من وزن الجسم) ، والمورفين (1-2 مجم / كجم من وزن الجسم) ، واليوريتان (750 مجم / كجم من وزن الجسم) ، والتنبيب والتهوية الاصطناعية باستخدام فأر مصمم خصيصًا جهاز التنفس الصناعي ، مع أكسجين مستوحى 100٪ بحجم مدّي 200 ميكرولتر وتردد 120 نفساً في الدقيقة. كانت معدلات ضربات القلب قريبة من المعدل الطبيعي (& gt500 نبضة في الدقيقة). تم قسطرة LV باستخدام طعنة قمي مكشوفة عن طريق بضع الصدر المحدود. تم تسجيل الإشارات في حالة ثابتة وأثناء تقليل الحمل العابر الناتج عن الانسداد المؤقت للوريد الأجوف السفلي. تم أخذ عينات من البيانات عند 2 كيلو هرتز وتحليلها باستخدام برنامج مخصص. بعد جمع البيانات الأولية ، تم وضع مسبار الموجات فوق الصوتية للتدفق حول الأوعية الدموية (1RB Transonics ، إيثاكا ، نيويورك ، الولايات المتحدة الأمريكية) حول الشريان الأورطي الصدري لقياس النتاج القلبي. تم استخدام حجم الضربة لمعايرة الأحجام النسبية المقاسة في وقت واحد بواسطة إشارة القسطرة الحجمية ، ومطابقة قيمتها مع متوسط ​​عرض حلقة الضغط والحجم. تمت معايرة التغييرات النسبية ومعظم المعلمات الدورة الدموية المشتقة ، على الرغم من أن الحجم المطلق لم يكن كذلك. تم عمل أوزان القلب والفحوصات التشريحية الإجمالية بعد الانتهاء من كل دراسة. تم إجراء مقارنات بين الفئران من النوع البري والمتحولة MyBP-C بواسطة Student ر الاختبارات. يتم الإبلاغ عن جميع البيانات كوسائل ± SEM و ص القيم الأقل من 0.05 التي تم الإبلاغ عنها عدديًا ، يشار إلى القيم الأعلى على أنها غير مهمة.

أليلات البناء MyBP-C (Neo) و MyBP-C (LoxP). تم عزل جزء من جين MyBP-C الفئران من مكتبة الجينوم λ DASH للبكتيريا وتحديد تسلسل النيوكليوتيدات الخاص بها (غير منشور). تم تحديد Exons 29-31 على 7.4 كيلو بايت Speأنا جزء تم استنساخه من الباطن لجين مقاومة النيوميسين (PGK- نيو بولي أ) المحاط بتسلسل LoxP في exon 30 (الشكل 1 أ والطرق). تم استخدام هذا البناء لتعطيل جين MyBP-C الداخلي في الخلايا الجذعية الجنينية عن طريق إعادة التركيب المتماثل وتم تحديد الأليل المستهدف MyBP-C (نيو). يتم حقن الكيسات الأريمية بخلايا جذعية جنينية تحمل MyBP-C (نيو) أنتج الأليل حيوانات خيمرية. كانت كمية MyBP-C mRNA المتحولة في أنسجة القلب من الفئران التي تحمل هذا الأليل أقل بكثير من كمية MyBP-C mRNA الموجودة في الفئران البرية (انظر أدناه). افترضنا أن كمية MyBP-C mRNA الطافرة قد انخفضت لأن تسلسل الجين المقاوم للنيومايسين في mRNA الطافر تسبب في تدهور الحمض النووي الريبي بسرعة أو لأن هذه التسلسلات غيّرت معالجة سلائف MyBp-C RNA. لاختبار هذه الفرضية ، تم تحديد أليل ثانٍ MyBP-C (LoxP)، عن طريق تزاوج الفئران الوراثية MyBP-C (Neo) مع فأرة معدلة وراثيا تعبر عن CRE. ال MyBP-C (LoxP) نتج الأليل عن استئصال الجين المقاوم للنيومايسين بواسطة ريكومبيناز CRE ويحتوي على ما تبقى من 97-بي بي تسلسل LoxP مكرر (الشكل 1 أ والبيانات غير معروضة). تم تربية نسل متغاير الزيجوت من حيوانات خيمرية لإنتاج فئران متماثلة اللواقح لأي من MyBP-C (نيو) أو MyBP-C (LoxP) أليل. تميزت الفئران المتماثلة اللواقح لكل أليل بتحليلات اللطخة الجنوبية وتضخيم PCR لـ MyBP-C (LoxP) أليل مع الاشعال 1F ، 1R (الشكل 1 أ) و MyBP-C (نيو) أليل مع الاشعال 1F ، 3R و 2F ، 2R (بيانات الشكل 1 أ غير معروضة). كانت الفئران متماثلة اللواقح MyBP-C (Neo) و MyBP-C (LoxP) خصبة ، وأنتجت أحجامًا طبيعية من القمامة ، وعاشت لأكثر من عام واحد.

مرنا القلب MyBP-C وتعبير البروتين من أليلات MyBP-C متحولة. تم تقييم كميات MyBP-C mRNA القلبي في MyBP-C (LoxP) وقلوب الفئران MyBP-C (Neo) بواسطة تحليلات اللطخة الشمالية. تم تقليل نصوص MyBP-C القلبية الوفيرة (4.5 كيلو بايت) الموجودة في الفئران البرية بشكل ملحوظ في LV (14.5 ± 4٪) ن = 6) ، RV (9.5 ± 1٪ ن = 3) والأذينين (18.4 ± 5٪) ن = 3) من الفئران MyBP-C (الجدد) (الشكل 2 أ والبيانات غير معروضة). احتوت أنسجة القلب من الفئران MyBP-C (Neo) وفئران MyBP-C (LoxP) على نفس الكمية تقريبًا من MyBP-C mRNA القلبي (البيانات غير معروضة).

MyBP-C mRNA ومستويات التعبير عن البروتين في قلوب الفئران متماثلة اللواقح MyBP-C (Neo) البالغة من العمر 12 أسبوعًا (المعينة t / t). (أ) تحليلات اللطخة الشمالية للـ RNAs من البطين الأيسر من النوع البري (+ / +) وفئران MyBP-C (Neo) المهجنة باستخدام تحقيقات الفئران MyBP-C و GAPDH. (بحددت تحليلات اللطخة الغربية بروتين MyBP-C 150 كيلو دالتون في مقتطفات ليفي عضلي من LV من النوع البري (+ / +) وفئران MyBP-C (Neo) متماثلة اللواقح (t / t).

تميزت بنية الحمض النووي الريبي MyBP-C القلبي المُنتَج من كل أليل بتحليلات تسلسل النوكليوتيدات للمنتجات المُضخَّمة RT-PCR المشتقة من الحمض النووي الريبي الكلي لقلب الفأر المتماثل (انظر الطرق). تمت مقارنة هياكل متواليات MyBP-C القلبية الموجودة في قلوب الفئران الطافرة بتسلسلات الحمض النووي الريبي من النوع البري وكانت متوافقة مع النموذج الذي نتج عن RNAs المتحولة المختلفة من أنماط لصق بديلة (الشكل 1 ، أ و ب). وهذا هو ، RNA مشتق من MyBP-C (نيو) أليل يقسم exon 30 بينما RNA مشتق من MyBP-C (LoxP) افتقر الأليل إلى الجزء 5 من exon 30 لأن الحمض النووي الريبي مقسم من نهاية 3 من exon 29 إلى تسلسل LoxP (الشكل 1). تختلف polypeptides MyBP-C المتحولة المتوقعة المشفرة بواسطة أليلات MyBP-C المعدلة في نهايتها الكربوكسيلية (الشكل 1 ب). ال MyBP-C (LoxP) ينتج الأليل بروتينًا يحتوي على 166 من بقايا الأحماض الأمينية الجديدة و 30 بقايا أقصر من البروتين من النوع البري ، في حين أن بروتين MyBP-C (Neo) هو 174 بقايا من الأحماض الأمينية أقصر من البروتين من النوع البري ويحتوي على 32 من الأحماض الأمينية الجديدة المخلفات (الشكل 1 ب).

تم تقييم كمية الببتيد الطافر الموجود في بطينات الفئران المتماثلة اللواقح MyBP-C من خلال تحليلات اللطخة الغربية. حددت الأجسام المضادة Polyclonal MyBP-C بروتين 150 كيلو دالتون في البروتين الكلي LV ومستحضرات البروتين العضلي الليفي المخصب التي تم دمجها مع الدجاج MyBP-C (الشكل 2 ب والبيانات غير معروضة). على الرغم من أن البروتين المتحور من الفئران MyBP-C (Neo) كان نظريًا أصغر بمقدار 15 كيلو دالتون من بروتين MyBP-C من النوع البري ، فقد هاجرت البروتينات الطافرة والبرية في نفس الموضع تقريبًا على هلام SDS-PAGE 6٪. (لماذا يصاحب الببتيد الطافرة الأصغر مع البروتين من النوع البري الكبير غير مؤكد). كان بروتين MyBP-C القلبية الطافرة في إجمالي متجانسات البروتين في LV من الفئران MyBP-C (Neo) 2.3 ± 1 ٪ (ن = 6) ، المقدار الموجود في مقتطفات مماثلة من النوع البري (البيانات غير معروضة). تحتوي مستخلصات اللييفات العضلية على ببتيد متحور أكثر بكثير من الكميات المقابلة من مستخلص البروتين الكلي. كانت مستويات بروتين MyBP-C القلبية الطافرة في مستخلصات اللييفات العضلية 9.5 ± 3 ٪ (ن = 8) كمية MyBP-C في مقتطفات الليفي العضلي من النوع البري (الشكل 2 ب). أظهرت تحليلات مماثلة أن البروتين المتحور MyBP-C (LoxP) قد تم إثرائه أيضًا في الجزء الليفي العضلي مقارنة بالكمية في الجزء السيتوبلازمي الكلي (البيانات غير معروضة).

مورفولوجيا القلب من الفئران متماثلة اللواقح MyBP-C متحولة. تم تمييز بنية القلب في الفئران الطافرة MyBP-C في عمر 8-12 أسبوعًا. تم تكبير القلوب من كل من الفئران المتجانسة MyBP-C (Neo) والمتماثلة اللواقح MyBP-C (LoxP) بشكل واضح مقارنة بتلك الموجودة في الفئران من النوع البري ، وكانت اللوحات المتكلسة موجودة على جدران غرفة LV لقلوب الفئران MyBP-C المتجانسة. ولكن ليس الفئران من النوع البري (الشكل 3 والبيانات غير معروضة). إجمالي أوزان القلب في الحيوانات الطافرة مقابل الحيوانات البرية (177.0 ± 5.7 مجم ، ن = 26 مقابل 113.8 ± 3.8 مجم ، ن = 25) وأوزان الجهد المنخفض (136.0 ± 7.5 مجم ، ن = 12 ، مقابل 80.0 ± 4.8 مجم ، ن = 11) زادت بشكل ملحوظ (ص & lt 0.001). كانت أوزان القلب إلى الجسم ونسب وزن LV إلى الجسم أكبر أيضًا في الفئران MyBP-C الطافرة مقارنة بالفئران البرية (الشكل 3 ب). في المقابل ، كانت الأذين الأيمن والأيسر RV ذات حجم وأوزان قابلة للمقارنة في الفئران المتحولة والبرية (الشكل 3 والبيانات غير معروضة).

مقارنة قلوب من 8-12 أسبوعًا من الفئران البرية ومتجانسة الزيجوت. (أ) التشكل الإجمالي للقلوب المتماثلة اللواقح MyBP-C (Neo) (المعينة t / t) والبرية من النوع (+ / +) القلوب و (ب) تُظهر نسب وزن القلب إلى الجسم أو نسب الوزن المنخفض إلى الجسم زيادات كبيرة (ص & lt 0.001) في الحجم القلبي للفئران المتحولة متماثلة اللواقح (t / t) مقابل الفئران من النوع البري (+ / +).

أظهر كل من القلوب المتجانسة MyBP-C (Neo) و MyBP-C (LoxP) تشوهات نسيجية بارزة ، بما في ذلك تضخم الخلايا العضلية ، والاضطراب العضلي الليفي ، والتليف. بالإضافة إلى ذلك ، كان 3 من 5 قلوب متحولة بها تكلس ضمور (الشكل 4 ، ب و د) ، والتي تختلف في المدى والموقع. تم العثور على تكلسات LV و RV البؤرية والتكلس داخل الأعصاب متعدد البؤر في 2 من 5 قلوب ، بالإضافة إلى تكلس تحت الشغاف مع تليف خلالي متعدد البؤر (1 من 5 قلوب) ، وعضلة حليمية تحت القلب مع تليف خفيف حول الأوعية الدموية (1 من 5 قلوب).

علم الأنسجة من 8-12 أسبوعًا من النوع البري (أ) و MyBP-C (نيو) (بد) قلوب الفأر. كانت الأقسام ملطخة بـ H & ampE (أ و ج) أو ماسون ثلاثي الكروم (ب و د).

تم فحص ساركوميرز من قلوب الماوس MyBP-C (Neo) متحولة متماثلة اللواقح بواسطة المجهر الإلكتروني (الشكل 5) كانت القسيمات القسيمية لقلوب الفأر هذه منظمة جيدًا مع العصابات A ، العصابات I ، والخطوط Z المتباعدة بشكل منتظم. كانت العصابات مماثلة لتلك التي لوحظت في الأورام اللحمية من الفئران من النوع البري. غالبًا ما كان الخط M غائبًا في الأورام اللحمية من LV لفئران MyBP-C متماثلة اللواقح (الشكل 5) ، ولكن في الأورام اللحمية المشتقة من RV ، تم العثور على خطوط M محددة جيدًا (البيانات غير معروضة).

صور مجهرية إلكترونية لنقل الأورام اللحمية من النوع البري البالغ من العمر 12 أسبوعًا (أ) وقلوب الماوس MyBP-C (Neo) (t / t). لاحظ المظهر غير المعتاد للخط M (علامة النجمة) في الأورام اللحمية المشتقة من الماوس MyBP-C (Neo). بار ، 0.5 ميكرومتر.

وظيفة القلب للفئران متماثلة اللواقح التي تحمل أليلات MyBP-C متحولة. تم تقييم وظيفة القلب في الفئران متماثلة اللواقح MyBP-C (Neo) البالغة والولدان باستخدام تخطيط صدى القلب عبر الصدر (الشكل 6 ، أ - ج ، والبيانات غير معروضة انظر الطرق). عند الولادة (0-3 أيام) وطوال فترة البلوغ (من 3 أسابيع بعد الولادة) ، أظهرت قلوب الفئران المتحولة MyBP-C زيادة في القطر الانبساطي والضغط الانقباضي للضغط المنخفض بالإضافة إلى انخفاض تقصير LV الجزئي (الجدول 1). تم استخدام سمك جدار الجهد المنخفض لتقييم ما إذا كان تضخم البطين موجودًا. في فترة حديثي الولادة ، لم يكن سمك جدار LV الأمامي والخلفي في الفئران MyBP-C المتحولة متماثلة اللواقح مختلفًا بشكل كبير عن سمك جدار الفئران من النوع البري بعد تصحيح فروق وزن الجسم (الجدول 1). مع تقدم العمر في الفئران البرية والمتحولة ، زاد سمك جدار LV ، ومع ذلك ، كانت هذه الزيادة أكبر في الفئران المتجانسة متماثلة اللواقح MyBP-C ، وبحلول 8 أسابيع من العمر ، كان لدى الفئران المتحولة جدران LV أكثر سمكًا من الفئران من النوع البري (الجدول 1) . تم أيضًا زيادة LAD من الفئران المتماثلة اللواقح MyBP-C بشكل ملحوظ مقارنة بالفئران من النوع البري (1.77 ± 0.13 مم مقابل 1.53 ± 0.08 مم ص = 0.01) في عمر 8-12 أسبوعًا. لوحظ وجود مادة كثيفة الصدى ، متوافقة مع تكلس العضلات الحليمية والآفات البؤرية داخل LV ، في جميع (10 من 10) فئران متحولة متماثلة اللواقح MyBP-C في 8 أسابيع في 6 حيوانات ، كانت هذه التغييرات معتدلة إلى شديدة.

وظيفة القلب في الفئران البرية و MyBP-C (Neo). (أج) اقتفاء أثر تخطيطي و M-mode لتخطيط صدى القلب من النوع البري البالغ من العمر 12 أسبوعًا (ب) و MyBP-C (Neo) الفئران (ج). تُحسب أبعاد LV من قياسات الجدار الأمامي (1) ، والجدار الخلفي (2) ، وقطر نهاية الانبساطي (3) ، وقطر نهاية الانقباض (4). قد يعكس التباين المتزايد في العضلة الحليمية الخلفية التكلس (ج) (سهم). (د) علاقات حجم الضغط وملفات تعريف dP / dt للنوع البري (+ / +) وفئران MyBP-C (Neo) (t / t).

أبعاد البطين الأيسر من الفئران MyBP-C متحولة من النوع البري ومتجانسة

تم تقييم وظيفة القلب للفئران متماثلة اللواقح MyBP-C (Neo) في الفئران المخدرة عن طريق القسطرة في الجسم الحي (31). أظهرت حلقات الضغط الحجم التي تم الحصول عليها من الفئران متماثلة اللواقح MyBP-C (Neo) والفئران البرية اختلافات كبيرة بين وظيفة القلب لهاتين السلالتين (الشكل 6 د). على الرغم من أن مرحلة الانقباض كانت طبيعية ، إلا أن التشوهات كانت واضحة مع بداية الانقباض ، بما يتفق مع تقصير كسري غير طبيعي لوحظ في دراسات تخطيط صدى القلب. انعكس المظهر غير الطبيعي للانكماش الانقباضي في العديد من المعلمات الكمية (الجدول 2). الخصائص الانبساطية (dP / dTدقيقة، ديسيبل / دي تينسبة، حجم نهاية الانبساطي (SW(EDV)) ، والوقت حتى الذروة ، ووقت الاسترخاء (تاو) ، والامتثال للغرفة (بيتا الطبيعي) كانت غير طبيعية. معدلات ضربات القلب ، ديسيبل / دي تيالأعلىلم يكن ضغط نهاية الانبساطي وضغط نهاية الانقباض مختلفين بين الفئران الطافرة والبرية.

تم تقييم وظيفة القلب لفئران عمرها 12 أسبوعًا عن طريق قسطرة القلب في الجسم الحي

تعبير الحمض النووي الريبي والبروتين المرتبط باعتلال عضلة القلب. تم فحص التعبير الجيني المتغير ، وهو سمة معترف بها لاعتلال عضلة القلب التوسعي (راجع المراجع 32 ، 33) ، في الفئران متماثلة اللواقح MyBP-C (Neo) و MyBP-C (LoxP). أعربت الفئران المتحولة عن الأكتين α- الهيكل العظمي بمستويات 16 و 8 أضعاف أعلى من تلك الموجودة في أنسجة LV و RV من فئران من النوع البري (الشكل 7 أ). كان التعبير الأذيني عن الأكتين α- الهيكل العظمي مشابهًا في الحيوانات الطافرة والبرية. تمت زيادة التعبير عن الببتيد الناتريوتريك للدماغ (BNP) بمقدار 5.3 و 2.2 مرة في LV و RV للفئران المتحولة متماثلة اللواقح MyBP-C (Neo) ، مقارنة بالفئران البرية ، على التوالي ، ولكن التعبير في الأنسجة الأذينية لم يكن مختلفًا بشكل كبير.

التعبير الجيني المتغير في القلوب من الفئران MyBP-C (Neo). البقع الشمالية (أ) إظهار زيادة التعبير عن الأكتين والهيكل العظمي BNP mRNAs مقارنة بنصوص GAPDH. مواد هلامية SDS ملونة بالفضة (ب) يوضح التعبير المتغير عن الأشكال الإسوية لـ MHC القلبي في إجمالي المستخلصات البطينية من قلوب الفئران MyBP-C (Neo) (من 8-12 أسبوعًا من الحيوانات المعينة t / t) مقارنة بالبروتين من الفئران من النوع البري (+ / +).

يتم تغيير التعبير عن الأشكال الإسوية α و للقلب معقد التوافق النسيجي الكبير في العديد من نماذج اعتلال عضلة القلب التوسعي. الشكل الإسوي السائد (85٪) في LV من الفئران البرية هو α-MHC ، بينما 15٪ فقط هو β-MHC (25) (الشكل 7 ب). زادت أنسجة MyBP-C LV المتجانسة المتجانسة بشكل ملحوظ من التعبير عن β-MHC (48 ٪) ، في حين تم تقليل التعبير عن الشكل الإسوي α-MHC إلى 52 ٪.

لتحديد ما إذا كانت البروتينات التي تنظم دوران الخلية العضلية Ca 2+ قد تم تغييرها في عضلة القلب المتجانسة في عضلة القلب ، قمنا بقياس مستويات الحمض النووي الريبي الساركوبلازمي Ca 2+ -ATPase (SERCA). لم يلاحظ أي اختلافات في مستويات SERCA mRNA في LV ، RV ، أو الأذين من الفئران الطافرة من النوع البري ومتماثلة اللواقح (البيانات غير معروضة).

لقد أنتجنا سلالتين من الفئران تحمل أليلات متحولة من جين MyBP-C القلبي. الفئران متماثلة اللواقح التي تحمل هذه الأليلات خفضت مستويات (& lt 10٪ طبيعي) من الببتيدات MyBP-C المعدلة طفريًا المعبر عنها في أنسجة القلب. الببتيدات المعدلة أقصر من النوع البري MyBP-C ولها تسلسلات جديدة في نهايتها الكربوكسيلية (الشكل 1 ب). أليل الفأر المتحولة MyBP-C (نيو) الموصوفة هنا ترميز الببتيد المعدل المشابه للببتيدات الطافرة الموجودة في بعض الأفراد المصابين بـ FHC (الشكل 1 ب والأسرة NN في المرجع 3). كل من طفرة Family NN و MyBP-C (نيو) ينتج الأليل MyBP-C RNA الذي يفتقر إلى exon 30 لأن السلف RNA الوصلات من exon 29 إلى exon 31 (الشكل 1 أ). يخلق اللصق البديل تغييرًا في الإطارات يتسبب في قيام الحمض النووي الريبي المتحور بتشفير بروتين مبتور (الشكل 1 ب). يصاب البشر أو الفئران المتغايرة الزيجوت التي تحمل هذه الطفرات باعتلال عضلة القلب التضخمي. ومع ذلك ، يوضح تخطيط صدى القلب والقسطرة القلبية في الجسم الحي أن النتيجة الوظيفية لأليلات MyBP-C المتحولة متماثلة اللواقح هي اعتلال عضلة القلب التوسعي. الفئران متماثلة اللواقح التي تحمل أليلات MyBP-C الطافرة تعاني من خلل في البطين عند الولادة ، والذي يستمر طوال الحياة ويصاحبه تضخم LV تعويضي تدريجي. تشمل المظاهر النسيجية للمرض تضخم الخلايا العضلية البارز ، والاضطراب العضلي الليفي ، والتليف ، والتكلس الضمور.يعد التعبير الجيني المتغير في أنسجة القلب من الفئران الطافرة متماثلة اللواقح نموذجيًا للأنماط الموجودة في نماذج أخرى من اعتلال عضلة القلب التوسعي (32 ، 33): تم العثور على الأكتين الهيكلي و BNP mRNAs عند مستويات عالية ويتم تغيير التعبير الإسوي للميوسين. توفر هذه الدراسات نظرة ثاقبة للوظيفة الطبيعية لـ MyBP-C ، وهي الآلية التي تسبب بها الطفرات في هذا الببتيد مرضًا بشريًا ، وتشير كذلك إلى الارتباط الجزيئي لاعتلال عضلة القلب الضخامي والمتوسع.

أثناء التطور الجنيني ، يرتبط ظهور MyBP-C بظهور الخطوط المتقاطعة (13) ، مما يشير إلى دور تنموي لهذا الجزيء في محاذاة الخيوط السميكة داخل الأورام اللحمية. نظرًا لأن أليلات MyBP-C المتحولة الموصوفة هنا تشفر تسلسلات الببتيد المقطوعة التي تشارك في ربط الميوسين ومستوى الببتيد المُقصر مسبقًا أقل بشكل ملحوظ من MyBP-C الطبيعي ، فقد فوجئنا بشكل خاص بالعثور على قسيم عضلي شبه طبيعي في قلوب متحولة. لم تتأثر أنماط النطاقات أو طول القسيمات اللحمية سلبًا بعجز MyBP-C. تشير هذه البيانات إما إلى دور غير أساسي لـ MyBP-C في تكوين وصيانة البنية التحتية للقسيم العضلي الدقيق أو ، بدلاً من ذلك ، تشير إلى أن الجزيئات الأخرى (ربما MyBP-H) يمكن أن تحل محل وظائف MyBP-C هذه. على أي حال ، فإن MyBP-C غير مطلوب بكميات متكافئة لإنتاج قسيم عضلي طبيعي المظهر.

أظهر الفحص المجهري الإلكتروني للإرسال لأنسجة LV من الفئران المتماثلة اللواقح التي تحمل أليلات MyBP-C الطافرة أن النطاق M كان غالبًا أقل تميزًا وغير متجانس مقارنةً بتلك الموجودة في العينات من النوع البري. تتكون العصابات M بشكل أساسي من المكونات المرتبطة بالخيوط السميكة ، MyBP-C ، و M-protein ، و skelemin ، و myomesin. عادةً ما يشكل MyBP-C من 7 إلى 9 خطوط في المنطقة C من النطاق A ، على جانبي النطاق M (11-13 ، 34). في حين أن النطاقات M-bands سيئة التحديد في LV من قلوب الفئران المتحولة متماثلة اللواقح يمكن أن تعكس التكوين المتغير لخطوط MyBP-C ، تشير العديد من النتائج إلى أن هذا النمط غير الطبيعي هو نتيجة لخلل القلب الواضح في الفئران الطافرة. أولاً ، تم العثور على مستويات مكافئة من الببتيد الطافر في غرفتي البطينين ، ومع ذلك ، بدت جميع النطاقات M في RV (وبعض نطاقات LV M) للحيوانات الطافرة طبيعية ، مما يعني أن قوى الدورة الدموية تؤثر على نمط النطاقات هذا. ثانيًا ، لوحظت أيضًا نطاقات LV M غير واضحة في الفئران التي تفرط في التعبير عن التروبومودولين ، وهو مكون خيط رفيع (35). نظرًا لأن كلا من الفئران المعدلة وراثيًا التروبومودولين وفئران MyBP-C الطافرة متماثلة اللواقح تتطور إلى اعتلال عضلة القلب التوسعي ، فإننا نقترح أن فقدان النطاق M داخل LV هو نتيجة وليس سببًا لخلل وظيفي في قسيم عضلي.

البشر متغاير الزيجوت الذين يعانون من طفرات الجين القلبية MyBP-C التي تشفر عديد الببتيدات المقطوعة يصابون باعتلال عضلة القلب الضخامي. الآلية التي تسبب بها هذه الأمراض غير واضحة لأنه لم يتم العثور على الببتيدات الطافرة MyBP-C ولا مستويات الببتيد المخفضة في كسور اللييف العضلي المحضرة من أنسجة القلب للفرد المصاب (18). تم الإبلاغ مؤخرًا عن الفئران المعدلة وراثيًا للتعبير عن MyBP-C القلبية الطافرة تحت محفز α-MHC (36) ، لكن المستويات كانت قوية جدًا لتقليل التعبير الجيني MyBP-C من النوع البري الداخلي. تقدم الفئران المتجانسة التي تحمل أليلات MyBP-C المتحولة دليلًا على أن جينات MyBP-C المتحولة التي ينظمها المروج الداخلي تنتج ببتيدات متحولة يبدو أنها مدمجة في الأورام اللحمية. وهذا يعني أنه تم العثور على ببتيد متحور بمقدار 4 أضعاف في مقتطفات اللييفات العضلية من مستخلصات الخلايا الكلية لنسيج LV (انظر الشكل 2 ب والنتائج). يشير توسيع نطاق هذه النتائج إلى البشر الذين يحملون عيوبًا مماثلة لجين MyBP-C القلبية إلى أن اعتلال عضلة القلب الضخامي ناتج عن التأثير السلبي السائد لببتيد MyBP-C الطافر على وظيفة قسيم عضلي ، على الرغم من أن احتمال انخفاض كمية MyBP-C له دور في عملية المرض لم يتم استبعاده.

قد تساعد الفئران التي تعبر عن عيوب جينية في ساركومير متماثل في معالجة جانب آخر من اعتلال عضلة القلب الضخامي البشري. أظهرت تحليلات النمط الظاهري والنمط الجيني في هذا الاضطراب تأثير المسببات الجينية على البقاء على قيد الحياة لدى الأفراد المصابين (للاطلاع على المراجعات ، انظر المراجع 8 ، 9). على الرغم من أن الفئران المعدلة وراثيًا والتي تكون متغايرة الزيجوت لطفرة جينية بشرية قد قدمت كواشف مهمة لتشريح بيولوجيا هذا المرض ، فإن التاريخ الطبيعي للمرض في هذه النماذج لم يكن مفيدًا في تحديد الطفرات التي تسبب الموت المبكر عند البشر. على سبيل المثال ، الأفراد المصابون بطفرة الميوسين Arg403Gln قصر متوسط ​​العمر المتوقع بشكل ملحوظ ، في حين أن الفئران ذات الطفرة المماثلة (المعينة α-MHC 403 / +) لديها بقاء طبيعي. على النقيض من ذلك ، فإن البقاء على قيد الحياة في 3 سلالات من الفئران المتماثلة اللواقح للطفرات البشرية الضخامية يحاكي بدقة الموت المبكر الذي لوحظ في البشر مع الطفرات المقابلة: تم تقليل البقاء على قيد الحياة بشكل ملحوظ في α-MHC 403/403 الفئران ولكن شبه الطبيعي في الفئران المتماثلة اللواقح أليلات MyBP-C متحولة. في حين أن دراسة طفرات اعتلال عضلة القلب الضخامي الأخرى ضرورية للتحقق من صحة هذه الملاحظات ، فإننا نقترح أن نماذج الفئران متماثلة اللواقح قد تكون كواشف قيّمة لتحديد سمات البقاء على قيد الحياة ، خاصةً لأن المعلومات السريرية ذات الصلة من البشر الذين يتشاركون الطفرة غالبًا ما تكون غير متوفرة.

أحد الأسئلة المهمة الناتجة عن هذه الدراسات هو كيف يتسبب اختلاف مضاعف في كمية بروتينات القسيم العضلي الطافرة في ظهور أنماط ظاهرية مختلفة بشكل ملحوظ: تضخم مقابل تمدد. أي أن الفئران متغايرة الزيجوت التي تحمل طفرات جينية لبروتين القسيم العضلي تطور اعتلال عضلة القلب الضخامي بينما الفئران الطافرة متماثلة اللواقح التي تحمل الطفرات نفسها تطور اعتلال عضلة القلب التوسعي. نحن نفترض أن معلمات وظيفة قسيم عضلي ، مثل توليد القوة ، يتم مراقبتها وتعمل كآلية إشارات مركزية تؤدي إلى مسارات مختلفة لإعادة تشكيل القلب. عندما تضعف القوة الناتجة عن مزيج من البروتينات القسيمية الطافرة والعادية بشكل كافٍ ، يحدث نمو الخلايا العضلية التعويضية ، مما يؤدي إلى تضخم القلب. ومع ذلك ، عندما تظل وظيفة القسيم العضلي غير كافية على الرغم من النمو (كما هو الحال في α-MHC 403/403 وقلوب MyBP-C المتحولة متماثلة اللواقح) ، يتم تنشيط مسارات أخرى ، كما يتضح من التعبير الجيني المتغير (على سبيل المثال ، أكتين α-skeletal actin و BNP و β -MHC) وموت الخلايا العضلية والتليف. إذا كانت شدة الخلل الوظيفي للقسيم العضلي هي الإشارة المركزية المتعلقة بهذه المسارات ، فإن امتداد هذا النموذج يتنبأ بأن القوى الخارجية على الخلية العضلية ، مثل الحمل الديناميكي الدموي أو إعادة تشكيل المصفوفة خارج الخلية ، يمكن أن تؤدي إلى تفاقم الخلل الوظيفي في قسيم عضلي جوهري وتقلب التوازن من التضخم المعوض نحو عدم التعويض. بالفشل. يمكن أن تفسر هذه الآلية تطور اعتلال عضلة القلب الضخامي إلى التوسعي.

نود أن نشكر Michael Giewat و John Gabrovsek على المساعدة التقنية. تم دعم هذا البحث من قبل معهد هوارد هيوز الطبي.

ساهم برادلي ك.ماكونيل وكارين أ. جونز بالتساوي في هذا العمل.


شاهد الفيديو: فيزياء التاسع النظام العالمي للوحدات التحويل من وحدة اصلية الى بادئة 4 (أغسطس 2022).