معلومة

هل تشترك القردة والبشر في 99٪ من الحمض النووي أو 99٪ من الجينات؟ ماهو الفرق؟

هل تشترك القردة والبشر في 99٪ من الحمض النووي أو 99٪ من الجينات؟ ماهو الفرق؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لقد قدمت إجابة على Scifi.SE يمكن قراءتها هنا. يتعلق الأمر بكيفية حصول الشخصيات في قصة Jurassic Park على الحمض النووي لجميع الأنواع المعروضة.

في جوابي قلت هذا:

القرود والبشر ، على سبيل المثال ، يتشاركون أكثر من 99٪ من جيناتهم. هذا يعني أن الفرق بين جنسنا البشري أقل من 1٪ من جيناتنا. في الواقع ، تشترك كل أشكال الحياة على الأرض بحوالي 50٪ من جيناتها.

لكن في المنشور الأصلي (قبل أن يحرره شخص ما) اخترت استخدام كلمة DNA بدلاً من الجينات.

ترك هذا التعليق في القسم لشرح التعديل:

آسف ، أنا عالم أحياء ، لا يمكنني مساعدتك. يشترك البشر والقردة بنسبة 99٪ في التشابه في تسلسل ترميز الحمض النووي الخاص بهم ، و ~ 5٪ الذي يرمز للجينات ، وليس في كل الحمض النووي. لقد قمت بتبسيط هذا على الجينات للإجابة.

لدي فهم أساسي في المدرسة الثانوية للحمض النووي والجينات ، لذلك أخشى أن أفشل في رؤية الفرق بين استخدام "الحمض النووي" أو استخدام "الجينات" في بياني. أفهم أن الجينات هي تسلسلات محددة من الحمض النووي التي تستخدمها الخلية بطريقة ما. أنا أفهم أن الحمض النووي أكثر عمومية ، بما في ذلك جميع الخيوط ، سواء تم استخدامها أم لا ، سواء كانت تبدو وكأنها ترمز لشيء ما أم لا.

فهل من الخطأ إذن القول إن القردة والبشر يتشاركون 99٪ من حمضهم النووي أم أنه من الصحيح أيضًا قول "جينات"؟


إذن ، درس سريع في البيولوجيا الجزيئية.

  • البروتينات هي الأشياء التي تشكل نسبة جيدة من خلايانا (والتي تشكل نسبة جيدة من نحن) ، وهي الأشياء التي تقوم بعمل الخلايا - العديد منها عبارة عن محفزات وتعرف باسم "الإنزيمات".
  • يتم ترميز البروتينات بواسطة الجينات - في حين أن العبارة القائلة بأن شفرة جينية واحدة لبروتين واحد ليست صحيحة تمامًا (يمكن لجين واحد أن يرمز لأشكال مختلفة من نفس البروتين الأساسي) ، إنها طريقة جيدة للتفكير في الأشياء في هذا السياق.

  • تتكون الجينات من الحمض النووي، وهو جزيء بوليمري يتكون من الكروموسومات لدينا ، ويوجد الجزء المعلوماتي منه بأربعة "أحرف" (قواعد كيميائية).

  • ومع ذلك ، نصل الآن إلى الجزء الرئيسي - على الرغم من ذلك جميع الجينات مصنوعة من الحمض النووي ، وليس كل الحمض النووي للكروموسومات يشكل الجينات. في الواقع ، كما ذكرterdon في تعليق ، فقط حوالي 5٪ (أو أقل) من الأربعة مليارات حرف في إجمالي الحمض النووي - الجينوم - تشكل الجينات - تلك التسلسلات التي
    رمز مباشرة للبروتين.

  • وظيفة بقية الجينوم ليست واضحة تمامًا. بعضها تنظيمي ، وبعضها قد يكون هيكليًا ، وقد يكون "خردة من الحمض النووي". ومع ذلك ، فقد ظل عالقًا لملايين السنين ، لذلك نفترض أنه يجب أن يكون له هدف ما. يختلف هذا الحمض النووي غير المشفر بين الأنواع إلى حد أكبر من الجينات نفسها ، لذلك ربما يساهم بطريقة ما في الاختلافات بين الكائنات الحية.


من AndroidPenguin

فيما يلي روابط لورقة بحثية حول وظيفة الحمض النووي "غير المرغوب فيه" من عام 2013.

  1. ملخص في نيويورك تايمز

  2. مجردة في الطبيعة

  3. قم بترميز المواضيع على موقع nature.com


نظرًا لأن تعديلي على سؤالك هو الذي بدأ كل هذا ، فقد أفكر جيدًا أيضًا. سأعطي مبسط نسخة من الجينات ونسخ الجينات ، هناك تفاصيل مختلفة تجعل العملية أكثر تعقيدًا مما سأصفه ولكنها ليست ذات صلة بالسؤال الأساسي هنا.

بادئ ذي بدء ، كما ذكر آخرون ، فإن الجينات هي سلاسل محددة من الحمض النووي. وظيفة الجين هي "ترميز" البروتين (أول تبسيط كبير). ومع ذلك ، لا الكل من الأكواد الجينية للبروتين ، فقط تلك الأجزاء منه تسمى exons (الصورة معدلة قليلاً من هنا):

الرسالة الرئيسية المأخوذة من الصورة أعلاه هي أن البتات الحمراء (الإنترونات) تتم إزالتها ولا تؤثر على منتج البروتين النهائي. لذا فقط جزء من الشفرات الجينية للبروتين. تميل الإنترونات إلى أن تكون أقل حفظًا بين الأنواع المختلفة من الإكسونات.

لا يقتصر الأمر على أن الجين بأكمله لا يرمز للبروتين ولكن معظم الجينوم لا يحتوي على جينات. في الواقع ، في البشر ، تمثل الجينات حوالي 5٪ من إجمالي الحمض النووي و exons تمثل ~ 2٪.

عامل محير آخر هو التسلسل يسمى العناصر المتكررة. هذه أنواع مختلفة من التسلسلات القصيرة التي توجد في العديد من النسخ في الجينوم ، في الجينوم البشري ، يتكون حوالي 41٪ من عناصر متكررة من أنواع مختلفة ، ويمثل حوالي 10٪ نسخًا من عنصر واحد (Alu) ، وهذا ضعف العدد. كجينات. عادة لا تؤخذ هذه العناصر المتكررة في الاعتبار عند حساب معدلات تشابه الجينوم الكامل.

من حيث بأكمله الجينوم والبشر والشمبانزي متشابهان جدًا. ومع ذلك ، تختلف النسب المئوية الدقيقة (لقد رأيت تقديرات من ~ 85 إلى ~ 90 شيئًا) اعتمادًا على طريقة دراسة التسلسلات. لتكون في الجانب الآمن ، يجب أن تقول أنهما يشتركان في تشابه بنسبة 99٪ على المستوى الجيني و اتركه هكذا.


فقط لتوضيح التعريفات ، يتكون الجينوم الخاص بك من تسلسل الحمض النووي. يتكون الحمض النووي من أربعة أزواج من الأحماض النووية أو النيوكليوتيدات (A ، G ، T ، C). يحتوي هذا الحمض النووي على العديد من المواقع داخله ، كل رموز للجين. يتم إعطاء Loci أسماء جينية مثل SHH (قنفذ صوتي) وهو جزء من تخصص يسمى تسمية الجينات. لدى البشر نسختان من كل جين ، واحدة من كل والد. هذه الجينات ، مثل SHH ، لها متغيرات مختلفة تسمى الأليلات. هذا هو المكان الذي ربما تكون قد سمعت فيه المصطلحين متماثل الزيجوت ومتغاير الزيجوت ، عندما يكون لدى الشخص نسختان من نفس الأليل أو نسختان مختلفتان على التوالي. قد تتذكر الحديث عن فقر الدم المنجلي في المدرسة الثانوية.

فهل من الخطأ إذن القول إن القردة والبشر يتشاركون 99٪ من حمضهم النووي أم أنه من الصحيح أيضًا قول "جينات"؟

حسنًا ، التشابه بين البشر والشمبانزي من حيث تسلسل الحمض النووي المعروف هو حوالي 98.8٪ ، وهناك اختلاف منخفض نسبيًا في التسلسل ، لذا في رأيي أنت محق في القول إنهم يشاركون 99٪ من حمضهم النووي. هذا يعني أنه في 100 نيوكليوتيد يوجد فرق واحد تقريبًا على سبيل المثال (تظهر 90 قاعدة ، تم إجراؤها باستخدام عينة عشوائية من أربعة أحرف في R):

حبلا الحمض النووي البشري:

atgactgtagcccatga ر gtaaacgtaccaagcctcctcggctgtcccgaaatagatacgcctggtagacgtattaatagtgagtaa ... cgt

الشمبانزي:

atgactgtagcccatga ج gtaaacgtaccaagcctcctcggctgtcccgaaatagatacgcctggtagacgtattaatagtgagtaa ... cgt

بعد قولي هذا ، نظرًا لوجود أكثر من 3،000،000،000 زوج قاعدي في الجينوم البشري (تسلسل 4 نيوكليوتيدات تشكل الحمض النووي) والتي تعادل 36000000 زوج قاعدي مختلف (بين البشر والشمبانزي) وهو ما يعادل على الأرجح اختلافًا كبيرًا. في بعض الأحيان ، حتى تعدد أشكال النوكليوتيدات الفردي (SNP ، يُنطق القصاصة) ، تغيير في زوج أساسي واحد فقط ، يمكن أن يؤدي إلى تغييرات قابلة للقياس الكمي:

ترتبط طفرة أساسية واحدة في جين APOE (صميم البروتين الشحمي E) بزيادة خطر الإصابة بمرض الزهايمر.

إليكم القليل من القراءة عن البشر مقابل الشمبانزي. قد ترغب أيضًا في رؤية هذا المنشور المماثل عن علم الأحياء SE.

لكن محرر منشورك الأصلي محق ... تم ترتيب المنطقة المتغايرة فقط.

"يشترك البشر والقردة بنسبة 99٪ في التشابه في تسلسل الترميز من حمضهم النووي "

غالبًا ما يُنظر إلى المنطقة المتجانسة اللون على أنها جزء ترميز البروتين في الحمض النووي ، وتشكل 92٪ من الجينوم (أعتقد أن هذا ربما يكون 92٪ من الجينات ، ولكنه جزء صغير فقط من الحمض النووي المادي).

الباقي ، الهيتروكروماتين ، يحتوي على معلومات غير متسلسلة ويمكن أن يؤوي بعض تباين الحمض النووي بين النوعين. أشارت بعض الأعمال إلى أن الكروماتين المغاير ، الذي كان يُعرف سابقًا باسم DNA غير المرغوب فيه ، له في الواقع بعض التأثير على السمات. على سبيل المثال في ذبابة الفاكهة كانت هناك دراسات أظهرت تأثيرات كروموسوم Y على الصفات على الرغم من أن كروموسوم Y متغاير اللون بشكل أساسي.


علاوة على ذلك: أعتقد أن أحد مصادر الالتباس الشائعة يأتي من استخدام كلمة جين. غالبًا ما يتم استخدامه بالتبادل للإشارة إلى أي منهما أليل أو مكان التركيز الجيني. عندما يقول شخص ما أن البشر والقردة يشاركون 99٪ من جيناتهم ، فإنهم يقصدون أنهم يشاركون 99٪ من مواقعهم الجينية. عندما يقول شخص ما أن الشخص يشارك 50٪ من جيناته مع أحد الوالدين ، فإن ذلك يعني أنه يتقاسم نصف الأليلات مع ذلك الوالد (نصف الأليلات تقريبًا فقط بسبب إعادة التركيب والطفرة). يمتلك الفرد كل (باستثناء العيوب الجينية مثل الحذف) نفس موقع والدهم.


تركز معظم الإجابات هنا على الاختلاف بين مفهومي "الحمض النووي" و "الجينات" جيدًا. ومع ذلك ، فإن هوية التسلسل بين البشر والشمبانزي لم يتم تغطيتها بشكل صارم ولا تزال غير واضحة مما تم الإجابة عليه. لذلك ، سوف أتناول ذلك بالتفصيل ، بحيث يتم أيضًا تغطية الجزء الأول من السؤال.

يختلف البشر والشمبانزي تقريبًا كل 100 نيوكليوتيد في تسلسل الحمض النووي الكلي. هذا لا يعني أن 98.5٪ من الجينات مشتركة. وهذا يعني أن البشر لديهم حوالي 98.5٪ (بشكل أكثر دقة حوالي 98.8٪ ، اتحاد الشمبانزي التسلسل والتحليل ، 2005) هوية متسلسلة مع الشمبانزي ، بغض النظر عن الإنديل. لقد عالجوا فروق الاندلس والنيوكليوتيدات بشكل منفصل و "يحسبون [د] الجتباعد النوكليوتيدات على مستوى التباين بين الإنسان والشمبانزي يصل إلى 1.23٪"التي تشمل المناطق الجينية و introns - لذلك من الواضح أيضًا المناطق غير الجينية. هوية التسلسل على المستوى الجيني يفترض أنه أكبر بكثير.

كما يقدم اتحاد تحليل تسلسل الشمبانزي وتحليله معلومات عن كيفية هيكلة هذا الاختلاف. يأتي الجزء الرئيسي (حوالي 85٪ من 30 - 35 مليون نيوكليوتيدات مختلفة) من الاختلافات الثابتة: الفرق الثابت هو موضع في الجينوم أحادي الصيغة الصبغية فيه كل انسان لديه ، على سبيل المثال ، حرف G و كل شمبانزي وفقًا لذلك ، يختلف الموقع بين النوعين كل فرد من الأنواع المعنية. الجزء الأصغر (حوالي 15٪) يأتي من مواقع متغيرة (SNP) في البشر أو متغيرة في الشمبانزي ، أو في كليهما (حتى أن هناك عددًا صغيرًا من المتغيرات القديمة جدًا ، أي. الأليلات المشتركة بين البشر والشمبانزي ، على سبيل المثال انظر أزيفيدو وآخرون ، 2015). لاحظ أن التقديرات تتحسن كلما تم ترتيب ومقارنة المزيد من الأفراد من الأنواع المعنية.


لقد قرأت للتو مقالًا يقول إن نسبة 99٪ غير صحيحة تقنيًا. للوصول إلى هذا الرقم ، كان عليهم تجاهل 25٪ من الحمض النووي البشري وأعتقد أن 18٪ من الحمض النووي للشمبانزي. أفترض أيضًا أن الإحصاء كان يشمل الحمض النووي المشفر فقط. لأنه إذا لم يكن ما اعتادوا الإشارة إليه على أنه الحمض النووي غير المرغوب فيه هو نفسه ، فإن إحصائيات الـ 99٪ لعام 2005 تبدأ في الظهور بشكل أقل دقة ومضللة بعض الشيء. https://futurism.com/watch-do-we-really-share-99-our-dna-chimps/


يختلف البشر والشمبانزي تقريبًا بين كل 100 نيوكليوتيد في تسلسل الحمض النووي الكلي ، وهذا لا يعني أن 98.5٪ من الجينات مشتركة ، بل يعني أن الإنسان يمتلك حوالي 98.5٪ (بتعبير أدق حوالي 98.8٪ ، اتحاد الشمبانزي التسلسل والتحليل ، 2005) تسلسل الهوية مع الشمبانزي ، متجاهلين indels. لقد عالجوا الاختلافات في indels والنيوكليوتيدات بشكل منفصل و "حساب [d] تباعد النوكليوتيدات على مستوى الجينوم بين الإنسان والشمبانزي ليكون 1.23٪" والذي يتضمن مناطق بين الجينات وإنترونات - لذلك من الواضح أيضًا أنه غير - المناطق الجينية: من المفترض أن تكون هوية التسلسل على المستوى الجيني أكبر بكثير.


يمكن للحمض النووي في دماغك أن يكشف ما يجعلك إنسانًا

الجنس البشري ، في نظري ، رائع. جنسنا ، الانسان العاقل، ينحدر من الرئيسيات ، ومع ذلك فقد تطورنا كثيرًا. يطرح السؤال: ما الذي يجعلنا وبالتالي تختلف عن أقربائنا المقربين ، القردة؟

للوهلة الأولى ، يبدو الحل بسيطًا. فقط قارن تسلسل الحمض النووي للبشر والقردة ولاحظ أين تباعدنا ، أليس كذلك؟ خاطئ. نحن نشارك أكثر من 99٪ من حمضنا النووي مع الشمبانزي ، أحد أقرب أقربائنا ، ومن بين الاختلافات الموجودة بالفعل ، قد لا يكون للكثير منهم أي تأثير على جعلنا بشرًا. قادت هذه المشكلة العلماء إلى دعم فرضية بديلة: ما يجعلنا بشرًا ليس مجرد تسلسل جيني ، ولكن كيف يمكننا تنظيم أي منها يتم التعبير عنها.

لا يتم التعبير عن جميع الجينات المشفرة في الحمض النووي الخاص بنا ، لذلك إذا كان البشر والقردة يتشاركون تقريبًا كل حمضهم النووي ، فربما تكون كيفية تنظيم جيناتنا (أي متى وأين ومدى قوة التعبير عن الجينات) هو ما يميزنا. هذه حيث يصبح الأمر صعبًا. لقد كان تحديًا مستمرًا للباحثين للعثور على الموقع الدقيق لـ "مخفتات الجينات" ، أو العناصر التنظيمية التي تم اختيارها بشكل إيجابي خلال تطور البشرية.

"الاختيار الإيجابي" هو جزء مهم للغاية من هذا التحدي. العناصر التي تم اختيارها بشكل إيجابي هي الأشياء التي بدأت كطفرة جينية ولكنها أصبحت في النهاية معيارًا في مجموعة سكانية حيث نجت الكائنات المصابة بالطفرة وتتكاثر في كثير من الأحيان. مخفتات الجينات التي تم تم اختياره بشكل إيجابي هم من يريد الباحثون دراستها.

لسنوات ، كان لدى العلماء الذين أرادوا دراسة العلاقة بين البشر والقردة قائمة من التحديات (مثل التحديات المذكورة أعلاه) لكن لم يكن لديهم حل. هذا حتى الآن.

توصل باحثون في المعهد السويسري للمعلوماتية الحيوية (SIB) وجامعة لوزان ، وكلاهما يقع في لوزان ، سويسرا ، إلى طريقة جديدة لتحديد مناطق كبيرة من هذه المنظمات الجينية المختارة بشكل إيجابي في الدماغ. يقول جيالين ليو ، المؤلف الرئيسي لهذه الدراسة ،

لقد أظهرنا لأول مرة أن الدماغ البشري قد شهد مستوى عالٍ بشكل خاص من الاختيار الإيجابي ، مقارنةً بالمعدة أو القلب على سبيل المثال. هذا مثير ، لأن لدينا الآن طريقة لتحديد المناطق الجينومية التي ربما تكون قد ساهمت في تطور قدراتنا المعرفية! "

دعونا نلقي نظرة على ما فعلوه ولماذا يجب أن نهتم.


سؤال : لقد قدمت إجابة على Scifi.SE يمكن قراءتها هنا. يتعلق الأمر بكيفية حصول الشخصيات في قصة Jurassic Park على الحمض النووي لجميع الأنواع المعروضة. في إجابتي ، قلت هذا: القرود والبشر ، على سبيل المثال ، يشاركون أكثر من 99٪ من جيناتهم. هذا يعني أن الفرق بين جنسنا البشري أقل من 1٪ من جيناتنا. في الواقع ، كل أشكال الحياة على الأرض

لقد قدمت إجابة على Scifi.SE يمكن قراءتها هنا. يتعلق الأمر بكيفية حصول الشخصيات في قصة Jurassic Park على الحمض النووي لجميع الأنواع المعروضة.

القرود والبشر ، على سبيل المثال ، يتشاركون أكثر من 99٪ من جيناتهم. هذا يعني أن الفرق بين جنسنا البشري أقل من 1٪ من جيناتنا. في الواقع ، تشترك كل أشكال الحياة على الأرض بحوالي 50٪ من جيناتها.

لكن في المنشور الأصلي (قبل أن يحرره شخص ما) اخترت استخدام كلمة DNA بدلاً من الجينات.

ترك هذا التعليق في القسم لشرح التعديل:

آسف ، أنا عالم أحياء ، لا يمكنني مساعدتك. يشترك البشر والقردة بنسبة 99٪ في التشابه في تسلسل ترميز الحمض النووي الخاص بهم

5٪ يرمز للجينات ، وليس كل الحمض النووي. لقد قمت بتبسيط هذا على الجينات للإجابة.

لدي فهم أساسي في المدرسة الثانوية للحمض النووي والجينات ، لذلك أخشى أن أفشل في رؤية الفرق بين استخدام "الحمض النووي" أو استخدام "الجينات" في بياني. أفهم أن الجينات هي تسلسلات محددة من الحمض النووي التي تستخدمها الخلية بطريقة ما. أنا أفهم أن الحمض النووي أكثر عمومية ، بما في ذلك جميع الخيوط ، سواء تم استخدامها أم لا ، سواء كانت تبدو وكأنها ترمز لشيء ما أم لا.

فهل من الخطأ إذن القول إن القردة والبشر يتشاركون 99٪ من حمضهم النووي أم أنه من الصحيح أيضًا قول "جينات"؟


هل تشترك القردة والبشر في 99٪ من الحمض النووي أو 99٪ من الجينات؟ ماهو الفرق؟ - مادة الاحياء

تشرح البيانات الجديدة الفرق بين البشر والشمبانزي على الرغم من التشابه في الحمض النووي بنسبة 99٪

أ.هـ. جعفر الله

نُشر في 02 أبريل 2006

في الستينيات ، تم كسر الشفرة الوراثية وتم توضيح دور t-RNA في تخليق البروتين. حصل ثلاثة علماء أمريكيين على جائزة نوبل في الطب وعلم وظائف الأعضاء (أحدهم ، الدكتور روبرت هولي ، قام بالعمل في مبنى حيث أقع الآن في معمل النبات والتربة والتغذية في الولايات المتحدة داخل حرم جامعة كورنيل). تم اكتشاف إنزيمات التلاعب في الحمض النووي خلال السبعينيات مما أدى إلى طرق التضفير الجيني في أواخر السبعينيات والدخول في تقنية الحمض النووي المؤتلف. كانت النتيجة الطبيعية لهذه الثورة هي تسلسل الحمض النووي بسرعة مذهلة ، والتي ولدت العديد من المجالات الجديدة في علوم الحياة ، وهي علم الجينوم ، والبروتيوميات ، والمعلوماتية الحيوية ، وما إلى ذلك.

بدأ العالم العلمي في تسلسل الجينوم الكامل لبعض البكتيريا ، والخميرة ، والفطريات ، والنباتات ، والحيوانات بما في ذلك الفأر والشمبانزي والإنسان. بسبب التقدم السريع في علم الجينوم ، فإن المعلومات الثاقبة الجديدة قد أثرت مجال التطور. لم يكن لدى تشارلز داروين أي فكرة عما يشكل الجين. لقد كان عالمًا طبيعيًا وعالم أحياء ميدانيًا درس الاختلافات في مناقير بين العصافير دون معرفة الجينات التي تشارك في تكوين المنقار في الطيور. الآن ، من خلال مقارنة تسلسلات الحمض النووي ، يمكن للعالم أن يستنتج استدلالًا على الجينات المطلوبة لتطوير نسيج أو بشكل أكثر دقة لتكويد البروتينات. تعمل العديد من البروتينات كإنزيمات (محفز حيوي) ، والتي هي في الأساس آلة نانوية.

في العقد الماضي ، قارن العلماء تسلسل الحمض النووي للعديد من الثدييات للنظر في أوجه التشابه في التسلسل بين الأنواع والأجناس المختلفة. أحد الاكتشافات المدهشة هو أن الحمض النووي للفأر والإنسان أظهر قدرًا هائلاً من التشابه (تشابه أكثر من 94-95٪). وعلى نفس المنوال ، أظهر الشمبانزي والبشر حوالي 99٪ من التشابه الجيني في التسلسل. لذلك ، كان العلماء في حيرة وتساءلوا - كيف يختلف البشر والشمبانزي عن اختلافهم ولكنهم يتشاركون 99٪ من الجينات؟

جاء الجواب اليوم (8 مارس 2007). بفضل عمل العلماء من أمريكا وأستراليا الذين يقولون الآن أن التغييرات في التعبير الجيني وليس الجينات ، هي سبب فصل البشر عن أقرب أقربائهم. كتبت كاتبة من رويترز بالاسم باتريشيا رياني مقالاً إخباريًا بناءً على منشور حديث في مجلة علمية أولية. طبيعة سجية.

التعبير الجيني هو عملية جزيئية يتم من خلالها تشغيل الجينات أو إيقاف تشغيلها. يمتلك البشر حوالي 30000 جين مشفر في الكروموسوم ولكن لا يتم تنشيط جميع الجينات أو ضبطها في نفس الوقت في كل خلية.

قال البروفيسور كيفن وايت ، الأستاذ في قسم علم الوراثة والبيئة والتطور في جامعة ييل ، وهو مؤلف مشارك لهذا المقال العلمي الأخير ، "نعتقد أن التعبير الجيني هو جزء رئيسي مما يفصل الشمبانزي والبشر.

تعاون البروفيسور وايت مع باحثين من جامعة شيكاغو في إلينوي ومعهد هول في باركفيل ، فيكتوريا في أستراليا ، حيث نظروا في التعبير الجيني لدى البشر والشمبانزي وإنسان الغاب وقرود الريسوس باستخدام طريقة علمية مطورة حديثًا تسمى تقنية المصفوفة الجينية لمقارنة مستوى التعبير عن 1056 جينًا في الأنواع الأربعة.

قال البروفيسور جلعاد من جامعة شيكاغو ، الذي قاد العمل ، "عندما نظرنا إلى التعبير الجيني ، وجدنا تغيرات طفيفة إلى حد ما في 65 مليون سنة من تطور المكاك وإنسان الغاب والشمبانزي." ومع ذلك ، لاحظوا أن الطفرات (التغييرات) كانت موجودة. أكثر تكرارا في مجموعة معينة من الجينات المعروفة باسم "عوامل النسخ" التي تتحكم في التعبير عن الجينات الأخرى. جادل الباحثون بأنه نظرًا لأن البشر تباعدوا عن أسلافهم من القرود خلال الخمسة ملايين سنة الماضية ، فقد حدثت هذه التغييرات في تلك الفترة الزمنية. يقول العلماء إن هذا التطور السريع في عوامل النسخ حدث فقط عند البشر.

منذ حوالي ثلاثين عامًا ، افترض باحثان ، ماري كلير كينج وآلان ويلسون ، أن الاختلاف الرئيسي بين البشر والشمبانزي قد يكون في التعبير الجيني.

يدعم البحث المنشور في مجلة Nature فرضية عمرها 30 عامًا للعلماء ماري كلير كينج وألان ويلسون الذين اقترحوا أن الاختلافات الرئيسية بين البشر والشمبانزي قد تكون في الطريقة التي يعبرون بها عن جيناتهم. لا يمكن اختبار الفرضية في السبعينيات بسبب نقص التكنولوجيا. الآن بعد أن أصبح رسم خرائط الجينوم وتكنولوجيا مصفوفة الجينات متاحة ، يمكن أن يختبر أنصار التطور صحة الفرضية. استخدم البروفيسور جلعاد وزملاؤه عينات من الكبد من خمسة ذكور بالغين من كل نوع من الأنواع الأربعة (الإنسان ، والشمبانزي ، وإنسان الغاب ، وقرود الريسوس) في دراستهم التاريخية.

ووجدوا أن حوالي 60 في المائة من الجينات في الكبد لديها مستويات ثابتة من التعبير لدى البشر والرئيسيات. ومع ذلك ، كان من المرجح أن تغير جينات عوامل النسخ أنماط تعبيرها أكثر من الجينات التي تنظمها.

لتلخيص العمل قال البروفيسور وايت: `` على وجه التحديد في النسب البشري ، تتغير عوامل النسخ أو تتطور في تعبيرها بوتيرة أسرع من السلالات الأخرى ، لا سيما بالمقارنة مع الشمبانزي.

الباحثون ليسوا متأكدين من سبب التحول في التعبير الجيني لدى البشر ، لكنهم يعتقدون أنه قد يكون بسبب بعض التغييرات في البيئة. يخطط فريق البحث لاستخدام أنواع أخرى من الأنسجة لفحص مجموعات كبيرة من الجينات في دراساتهم المستقبلية.


الحمض النووي الخاص بنا هو 99.9٪ مثل الشخص المجاور لنا - ونحن نتشابه بشكل مدهش مع الكثير من الكائنات الحية الأخرى

تمتلك أجسادنا 3 مليارات من اللبنات الجينية ، أو أزواج القواعد ، التي تجعلنا ما نحن عليه.

ومن بين هؤلاء الثلاثة مليارات من الأزواج الأساسية ، هناك كمية ضئيلة فقط هي التي تميزنا ، مما يجعلنا متشابهين جينيًا بنسبة 99.9٪ للإنسان التالي.

أظهر حديث TED حديث للفيزيائي ورجل الأعمال ريكاردو ساباتيني أن النسخة المطبوعة من الشفرة الجينية بأكملها ستشغل حوالي 262000 صفحة ، أو 175 كتابًا كبيرًا. من بين هذه الصفحات ، سيكون حوالي 500 صفحة فريدة بالنسبة لنا.

وذلك لأن قطعًا كبيرة من الجينوم تؤدي وظائف مماثلة في جميع أنحاء المملكة الحيوانية.

ألقِ نظرة على مدى تشابهنا وراثيًا مع كل شيء من حولنا:


بشر

كل كائن حي على هذا الكوكب له حمض نووي. هذه مادة ذاتية التكاثر تنقل المعلومات من كائن حي إلى آخر. تتكون أجسادنا من الملايين من لبنات البناء الجينية ، والمعروفة باسم أزواج القاعدة ، التي تشكل تشريحنا الجسدي.

هناك حوالي 3 مليارات زوج من قواعد الجينوم تجعل البشر مشابهين بنسبة 99.9٪ للغرباء من البشر من حولنا. ومع ذلك ، كشفت الأبحاث الحديثة حقيقة أن أقرب أقربائنا ، الشمبانزي ، يشبهون البشر جينيًا بنسبة 98.8٪. بالإضافة إلى ذلك ، القطط متشابهة بنسبة 90٪ وحتى نحل العسل يشترك في 44٪ من الحمض النووي.


Bonobos انضم إلى الشمبانزي كأقرب أقارب بشريين

يتعيَّن على الشمبانزي الآن أن يتشارك في تمييز كونه أقرب أقربائنا على قيد الحياة في مملكة الحيوان. قام فريق دولي من الباحثين بترتيب جينوم البونوبو لأول مرة ، مؤكدين أنه يشترك معنا في نفس النسبة المئوية من حمضه النووي كما تفعل الشمبانزي. وجد الفريق أيضًا بعض الاختلافات الصغيرة ولكنها محيرة في جينومات الأنواع الثلاثة - الاختلافات التي قد تفسر كيف لا يبدو أو يتصرف قرود البونوبو والشمبانزي مثلنا على الرغم من أننا نتشارك حوالي 99 ٪ من الحمض النووي لدينا.

تقول عضو الفريق وعالمة الأحياء الحاسوبية جانيت كيلسو من معهد ماكس بلانك للأنثروبولوجيا التطورية في لايبزيغ بألمانيا: "نحن مرتبطون ارتباطًا وثيقًا بالجينات ، ومع ذلك فإن سلوكنا مختلف تمامًا". "سيسمح لنا هذا بالبحث عن الأساس الجيني لما يجعل الإنسان الحديث مختلفًا عن كل من قرود البونوبو والشمبانزي."

منذ أن قام الباحثون بتسلسل جينوم الشمبانزي في عام 2005 ، عرفوا أن البشر يتشاركون حوالي 99٪ من حمضنا النووي مع الشمبانزي ، مما يجعلهم أقرب أقربائنا الأحياء. ولكن يوجد في الواقع نوعان من القردة يرتبطان ارتباطًا وثيقًا بالبشر: البونوبو (عموم بانيسكوس) والشمبانزي الشائع (الكهوف عموم). وقد دفع هذا الباحثين إلى التكهن بما إذا كان أسلاف البشر والشمبانزي والبونوبو يشبهون البونوبو أو الشمبانزي أو أي شيء آخر ويتصرفون به - وكيف تطورت الأنواع الثلاثة بشكل مختلف منذ انفصال سلف البشر عن سلف مشترك لـ قرود البونوبو والشمبانزي ما بين 4 ملايين و 7 ملايين سنة في إفريقيا.

اختار جهد التسلسل الدولي بقيادة ماكس بلانك البونوبو المسمى Ulindi من حديقة حيوان لايبزيغ كموضوع له ، ويرجع ذلك جزئيًا إلى أنها كانت أنثى (كان جينوم الشمبانزي من ذكر). تم الإبلاغ عن تحليل جينوم Ulindi الكامل ، الذي تم الإبلاغ عنه عبر الإنترنت اليوم في طبيعة سجية، يكشف أن قرود البونوبو والشمبانزي يتشاركون 99.6٪ من حمضهم النووي. هذا يؤكد أن هذين النوعين من القردة الأفريقية لا يزالان متشابهين إلى حد كبير مع بعضهما البعض وراثيًا ، على الرغم من أن مجموعاتها انقسمت في إفريقيا منذ حوالي مليون سنة ، ربما بعد أن تشكل نهر الكونغو وقسم السكان الأسلاف إلى مجموعتين. اليوم ، توجد قرود البونوبو في جمهورية الكونغو الديمقراطية فقط ولا يوجد دليل على تزاوجها مع الشمبانزي في إفريقيا الاستوائية منذ تباعدها ، ربما لأن نهر الكونغو كان بمثابة حاجز لمنع المجموعات من الاختلاط. وجد الباحثون أيضًا أن قرود البونوبو تشترك في حوالي 98.7٪ من حمضها النووي مع البشر - تقريبًا نفس الكمية التي تشاركها الشمبانزي معنا.

عندما قارن علماء ماكس بلانك جينوم البونوبو مباشرة مع جينوم الشمبانزي والبشر ، وجدوا أن جزءًا صغيرًا من حمضنا النووي ، حوالي 1.6 ٪ ، يتم مشاركته مع البونوبو فقط ، ولكن ليس الشمبانزي. ونحن نتشارك نفس الكمية تقريبًا من حمضنا النووي مع الشمبانزي فقط ، ولكن ليس البونوبو. تشير هذه الاختلافات إلى أن السكان الأسلاف من القردة التي أدت إلى ظهور البشر والشمبانزي والبونوبو كان كبيرًا جدًا ومتنوعًا وراثيًا - حيث بلغ عددهم حوالي 27000 فرد متكاثر. بمجرد انفصال أسلاف البشر عن أسلاف البونوبو والشمبانزي منذ أكثر من 4 ملايين سنة ، احتفظ السلف المشترك للبونوبو والشمبانزي بهذا التنوع حتى انقسم سكانهم تمامًا إلى مجموعتين قبل مليون سنة. احتفظت المجموعات التي تطورت إلى قرود البونوبو والشمبانزي والبشر بمجموعات فرعية مختلفة قليلاً من مجموعة الجينات المتنوعة لهذه المجموعة الموروثة من الأسلاف - وتقدم هذه الاختلافات الآن أدلة على حجم ومدى التنوع في تلك المجموعة السلفية.

في حين أن وظيفة الاختلافات الصغيرة في الحمض النووي في السلالات الثلاثة اليوم غير معروفة حتى الآن ، يرى فريق ماكس بلانك أدلة على أن البعض قد يكون متورطًا في أجزاء من الجينوم الذي ينظم الاستجابات المناعية ، وجينات قمع الورم ، وإدراك الإشارات الاجتماعية. يُظهر الشمبانزي الشائع ، على سبيل المثال ، اختيارًا لنسخة من الجين قد يكون متورطًا في مكافحة الفيروسات القهقرية ، مثل فيروس نقص المناعة البشرية - وهو متغير جيني غير موجود في البشر أو البونوبو ، والذي قد يفسر سبب إصابة الشمبانزي بسلالة أخف من فيروس نقص المناعة البشرية (تسمى فيروس نقص المناعة القرد) مما يفعل البشر. الفرق الآخر هو أن قرود البونوبو والبشر ، وليس الشمبانزي ، لديهم نسخة من البروتين الموجود في البول والذي قد يكون له وظيفة مماثلة في القرود كما هو الحال في الفئران ، والتي تكتشف الاختلافات في الرائحة لالتقاط الإشارات الاجتماعية.

"تعد هذه الورقة إنجازًا مرجعيًا مهمًا يرسي الأساس لأنواع أخرى من التحقيقات هومو بان الاختلافات "، كما تقول ماريلين روفولو ، عالمة الأنثروبولوجيا الجزيئية من جامعة هارفارد ، والتي لم تشارك في العمل. وبينما يدرس الباحثون الجينوم بعمق أكبر ، فإنهم يأملون في العثور على الاختلافات الجينية التي تجعل قرود البونوبو أكثر مرحًا من الشمبانزي ، على سبيل المثال ، أو البشر أكثر دماغي. يجب أن يزيل جينوم البونوبو أيضًا الحجج القائلة بأن البشر أكثر ارتباطًا بالشمبانزي ، كما يقول عالِم الرئيسيات فرانس دي وال من جامعة إيموري في أتلانتا. من على الطاولة "، يقول دي وال.

تم تحديث هذا العنصر ليعكس أن الشمبانزي والبونوبو نوعان من الشمبانزي قريبان بدرجة كافية من البشر لمشاركة 99.6 ٪ من الحمض النووي الخاص بهم. قاد جهود التسلسل الدولي ماكس بلانك المكونة من فرق متعددة بما في ذلك 454 علوم الحياة في برانفورد ، كونيتيكت. ووجد الباحثون أيضًا أن أسلاف البشر انفصلوا عن أسلاف قرود البونوبو والشمبانزي منذ أكثر من 4 ملايين سنة ، وليس أكثر من 5 ملايين سنة كما ورد في الأصل.


هل تشترك القردة والبشر في 99٪ من الحمض النووي أو 99٪ من الجينات؟ ماهو الفرق؟ - مادة الاحياء

علم 281 ، 5382 (4 سبتمبر 1998): 1432-1434

لقد عرف العلماء لعقود من الزمن أن 98٪ على الأقل من الحمض النووي البشري متطابق مع الحمض النووي للشمبانزي. الآن بدأوا أخيرًا في استكشاف الجينات التي تفصلنا عن القردة

نحن البشر نحب أن نفكر في أنفسنا على أننا مميزون ، وننفصل عن بقية مملكة الحيوان من خلال قدرتنا على التحدث والكتابة وبناء الهياكل المعقدة والتمييز الأخلاقي. ولكن عندما يتعلق الأمر بالجينات ، فإن البشر يشبهون نوعي الشمبانزي لدرجة أن عالم الفسيولوجيا جاريد دايموند قد أطلق علينا "الشمبانزي الثالث". لقد وجد ربع قرن من الدراسات الجينية باستمرار أنه في أي منطقة معينة من الجينوم ، يتشارك البشر والشمبانزي 98.5٪ على الأقل من الحمض النووي الخاص بهم. هذا يعني أن جزءًا صغيرًا جدًا من الحمض النووي البشري مسؤول عن السمات التي تجعلنا بشرًا ، وأن حفنة من الجينات تمنح بطريقة ما كل شيء بدءًا من المشي المستقيم إلى القدرة على تلاوة الشعر وتأليف الموسيقى.

[صورة الشمبانزي في وضعية قدمين بواسطة E. PERORELLI / YERKES REGIONAL PRIMATE RESEARCH CENTER] Aping it. قد يتبنى الشمبانزي وضعية الساقين العرضية ، لكنها تختلف بشكل كبير عن البشر في علم التشريح والسلوك.

لكن ما هي هذه الجينات ، قليلة العدد لكنها قوية التأثير؟ حتى الآن ، كان هناك القليل من التمويل أو البحث لتعقبهم ، وكان جينوم الرئيسيات شبه عذراء. "يمكنك كتابة كل ما نعرفه عن الاختلافات الجينية في مقالة مكونة من جملة واحدة" ، هكذا يسخر عالم الأعصاب توماس إنسيل ، مدير مركز يركيس الإقليمي لأبحاث الرئيسيات بجامعة إيموري في أتلانتا.

الآن هذا آخذ في التغير ، حيث أطلقت مجموعة مستمرة من علماء الوراثة وعلماء الأحياء التطورية دراسات جديدة للعثور على الاختلافات في الجينات والكروموسومات والكيمياء الحيوية للإنسان والشمبانزي. في الشهر المقبل ، سيبلغ الباحثون عن العثور على أول اختلاف كيميائي حيوي مهم بين البشر والقردة الأخرى: يفتقر البشر إلى شكل معين من جزيء سطح الخلية في كل مكان الموجود في جميع القردة الأخرى. أبلغت فرق أخرى عن اختلافات جديدة في ترتيبات الحمض النووي على صبغيات البشر والرئيسيات الأخرى.

وبدأت مشاريع التسلسل الجديدة في مقارنة قاعدة الحمض النووي للبشر والرئيسيات حسب القاعدة. تم افتتاح مركزين جديدين - في Yerkes و Leipzig - في وقت واحد في العام الماضي لدراسة التطور الجزيئي للقردة العليا الشهر المقبل ، في اجتماع دولي في شيكاغو ، سيدفع الباحثون من أجل مشروع دولي منظم لجينوم الرئيسيات (انظر الشريط الجانبي) . نظرًا لأن الرئيسيات أقل عرضة من البشر لأمراض معينة ، بما في ذلك السرطان والإيدز ، فإن الاختلافات في التسلسل هي أكثر من مجرد اهتمام تطوري وهي بالفعل تلفت الانتباه التجاري. قدمت إحدى شركات التكنولوجيا الحيوية في دنفر بولاية كولورادو بالفعل براءات اختراع على جينات بشرية وجينية رئيسية.

في الوقت الحالي ، لا يمكن لأحد ربط الاختلافات الجزيئية القليلة المعروفة مع مجموعة مألوفة من الاختلافات بين الشمبانزي والإنسان ، مثل شعر الجسم أو اللغة أو حجم الدماغ. لكن قادة البحث الجينومي والتطوري على حد سواء يقولون إن الوقت قد حان لاستكشاف هذه الروابط. "هذا أحد الأسئلة الرئيسية التي يود من يهتمون منا ببيولوجيتنا طرحها - كيف يبدو هذا الاختلاف بنسبة 1.5٪؟" يقول فرانسيس كولينز ، مدير المعهد القومي لأبحاث الجينوم البشري.

طُرح هذا السؤال لأول مرة في ورقة مطبوعة عام 1975 من قبل عالمة الوراثة ماري كلير كينغ وعالم الكيمياء الحيوية الراحل آلان ويلسون ، وكلاهما من جامعة كاليفورنيا ، بيركلي آنذاك. قاموا بمسح دراسات البروتين والحمض النووي ووجدوا أن متوسط ​​البروتين البشري كان أكثر من 99 ٪ متطابقًا مع نظيره في الشمبانزي ، وأظهرت طرق تهجين الحمض النووي الخشن في ذلك الوقت أن متوسط ​​تسلسل الحمض النووي كان متشابهًا تقريبًا (علم، 11 أبريل 1975 ، ص. 107). Thus, King and Wilson concluded, humans and chimpanzees were genetically as similar as sibling species of other organisms, such as fruit flies or mice.

This left a great paradox: Our DNA is almost identical to that of our chimp cousins, but we don't look or act alike. "The molecular similarity between chimpanzees and humans is extraordinary because they differ far more than many other sibling species in anatomy and way of life," the pair wrote.

What's more, much of the DNA in any organism is so-called "junk DNA" that has no apparent function, and mutations in these regions do not change the function of genes. Thus, many of the genetic differences between humans and chimps probably don't affect the organisms at all. The challenge is to find those few mutations that do make a difference--either by altering genes that code for proteins or by changing how genes are regulated, King and Wilson said.

But although many labs have since confirmed that our nuclear DNA is 98% to 99% identical to that of chimpanzees, few have taken on the quest to find the differences that matter. "It was one of those fields that fell through the cracks," says Ajit Varki, a glycobiologist at the University of California, San Diego (UCSD), who has recently surveyed the known differences between humans and apes.

The tools and funds for sequencing large amounts of DNA rapidly weren't available until recently. And this line of work required a bold shift in thinking for most labs. "Most people in comparative genetics ask what's similar and conserved," says molecular evolutionist Caro-Beth Stewart at the State University of New York, Albany, who trained with Wilson. "Just a few of us have been trying to ask: What's different? What makes us human?"

One way to answer that question is to start with biochemical differences, and then trace them back to their genetic origins. That approach has yielded its first big payoff, to be reported in the October issue of the American Journal of Physical Anthropology. After studying tissues and blood samples from the great apes and 60 humans from diverse ethnic groups, Varki and his colleagues Elaine Muchmore and Sandra Diaz at UCSD were surprised to find that human cells are missing a particular form of sialic acid, a type of sugar, found in all other mammals studied so far, including the great apes. "Now you've got something that is changing the surfaces of all cells in the body," says Varki.

The sialic acid molecule is found on the surface of every cell in the body, and previous work has shown that it can take on a surprising variety of roles. In some cases, it acts as a receptor for messages from other cells, but pathogens including those that cause cholera, influenza, and malaria also use it to gain a foothold on the cell. Chimpanzees are not as susceptible as humans to some of these pathogens, and the researchers speculate that this molecular change may be part of the reason why. There are even hints that sialic acid may be involved in cellular communication during brain development and function, says Varki.

The chimp and mammalian form of sialic acid, known as N-glycolyl-neuraminic acid (Neu5Gc), is modified from the basic form of the compound (called Neu5Ac) by the addition of an oxygen atom. But the human form is simply the basic acid, lacking the additional oxygen atom.

That changes the shape of the molecule in a region that could alter how it is recognized by other molecules, whether pathogens or cellular messengers, says Varki. Other researchers are intrigued: "I think this is really nice work," says Svante Pääbo, a molecular geneticist at the University of Munich and leader of a German effort to sequence ape genomes. "It's really the first difference [in the expression of a gene product] that has come up."

In recent months, Varki's team has traced this difference back to a gene that codes for a hydroxylase enzyme in apes, which adds the extra oxygen atom. Humans are missing a 92-base pair section of this gene, according to new results from a team of Japanese researchers, led by glycobiologists Akemi Suzuki and Yasunori Kozutsumi at Tokyo Metropolitan Institute. Varki's lab has a paper in press in the Proceedings of the National Academy of Sciences that includes similar studies on the gene in the great apes they are now also working on human fossils with Pääbo's lab to see if this change was recent in humans.

Yet the question still remains: Does this biochemical difference matter? No one has yet identified a specific function altered by the loss of this particular version of the molecule. "Until we know what this gene does, I remain skeptical of its importance," says Harvard University molecular anthropologist Maryellen Ruvolo. In search of clues, Kozutsumi is raising mice where the hydroxylase enzyme gene is knocked out, as it is in humans, to see if they produce the simpler form of sialic acid seen in humans--and if they have any anatomical or behavioral differences. "Maybe their mice will speak," jokes Varki, whose own lab is raising transgenic mice that overexpress hydroxylase in the brain to see if it affects anatomy or behavior.

But Ruvolo doesn't expect dramatic results: "Somehow, I can't believe that switching off the expression of this gene in adult humans is responsible for a myriad of important changes in human evolution." Most researchers, including Varki, agree that the difference won't come down to a single genetic change. "There won't be one magic gene that makes us human," says King, now at the University of Washington, Seattle.

Another tactic for finding the key differences is to start with chromosomes, because even a simple karyotype--a picture of the chromosomes--reveals that other apes have 24 pairs of chromosomes while humans have 23 pairs. While 18 of the 23 pairs are virtually identical in humans and other apes, it has long been known that the remaining pairs have segments that have been reshuffled since the great apes went their separate ways (علم, 19 March 1982, p. 1525). In recent years, several labs in the United States and Germany have been homing in on this chromosomal remodeling.

For example, the gene mutated in a rare human disorder called adrenoleukodystrophy--made famous by the movie Lorenzo's Oil--turns up on the X chromosome in chimpanzees and humans. But nonfunctioning copies of it also have been found in different places in the chimpanzee and human genomes (علم, 12 June, p. 1693). Chromosomes 4, 9, and 12 have also been remodeled differently in chimps and humans, according to work published last month in Genomics by human geneticists David Nelson and Elizabeth Nickerson of Baylor College of Medicine in Houston. For example, the researchers spotted a chunk of DNA that sits on chromosome 4 in all apes and humans, but in chimpanzees it has moved to a new spot on the same chromosome and been inverted. The translocated chunk includes a gene called AF4, which codes for a transcription factor--and is mutated in some forms of acute leukemia in humans. Because apes are much less prone to certain cancers, including leukemia, this is an intriguing finding, raising the possibility that the inversion alters the factor's expression in chimps and so helps protect them from leukemia, says Nelson.

Still, the functional significance of this and other chromosomal differences between humans and other apes is unknown. One possibility, says Nelson, is that similar remodeling disrupted specific genes in our primate ancestors, altering human physiology or function. Because sperm and eggs can't mingle their genetic material unless the chromosomes line up properly, he adds that such rearrangements could have created a reproductive barrier between our ancestors and other primates--the first step in creating new species like our own.

But others, such as Pääbo, think that chromosomal rearrangements at influential sites are rare and so are skeptical that they play a major role in the differences between chimp and human. Pääbo and King think instead that the most promising research avenue is to identify small sequence differences that subtly change the expression of genes that regulate the timing of development, such as those that code for transcription factors that might lengthen the growth period of the brain and, hence, allow more complex brain structure in human fetuses.

The sequencing efforts that may reveal these differences are now under way. Pääbo's group in Munich and Leipzig has sequenced a 10,156-base pair segment of DNA in the X chromosome of humans and chimpanzees, confirming again that they are about 99% similar. Now they're seeking differences in the expression of the identified genes in the brain and in the immune system.

And at GenoPlex Inc., a Denver-based company founded last year by University of Colorado Health Sciences Center geneticists Jim Sikela and Tom Johnson, researchers have come up with a rapid method to find meaningful sequencing differences between humans and chimps. After sequencing a stretch of DNA in each species, they count two different types of nucleotide differences: those that change the structure and function of a protein product, and silent substitutions that don't. If the ratio of replacement to silent substitutions is high, they consider that the gene sequence is likely to have undergone a functional change that was selected for in humans.

Preliminary results suggest that they have found uniquely human genes involved in AIDS susceptibility and learning and memory, says Walter Messier, an evolutionary biologist at the company. The firm has submitted patents on novel uses of these gene sequences, which they hope may become targets for new drugs.

Much of this work is in its infancy, but researchers say they are poised on the verge of a brave new world where they will be able to identify and tinker with the DNA that makes us human--and will face new ethical dilemmas. "What happens if scientists identify a human gene that controls development of the larynx--a gene that might give chimpanzees the anatomy needed for speech?" asks Edwin McConkey, a molecular biologist at the University of Colorado, Boulder. "Can you imagine the ethical debate involved in whether or not to create transgenic chimps? It will open a real Pandora's box."


Rapid emergence

The genome unravelled in the research came from a female western lowland gorilla (Gorilla gorilla gorilla) called Kamilah.

Researchers searched through more than 11,000 genes in her genome, as well as in the published versions of the human, chimp and orangutan genetic codes, for changes important in evolution.

"Our most significant findings reveal not only differences between the species, reflecting millions of years of evolutionary divergence, but also similarities in parallel changes over time since their common ancestor," said Chris Tyler-Smith, who works with Dr Durbin.

Comparative studies will also shed more light on the evolution of all the Great Apes but the key question is whether the bounty of genetic information contains clues to the moment when the first genes emerged that made humans capable of abstract thought.

"This is the question we are all fascinated by," Dr Durbin told BBC News.

It is unlikely that a single development led to our species' advance towards modernity, or that all developments along that path were genetic.

Anatomically modern humans (الانسان العاقل) emerged around 200,000 years ago, but it was not until about 50,000 years ago that our bigger brains began to make a difference.

Until then, humanity was one among small number of apes in Africa, probably living not very differently from gorillas.

So, something happened very rapidly around that time that led to the emergence of abstract thought, allowing humans to invent advanced tools and use them to shape the environment.

"There will have been genetic factors," said Dr Durbin, "but also cultural and historic factors."

The one Great Ape not to be sequenced so far is the bonobo, a close relative of the chimp. That project is underway, and scientists expect its genome and that of the chimp to be very similar.

The availability of the genomes of all the Great Apes will help scientists answer what happened over the past 200,000 years to enable our species become what we are now.


Stanford DNA survey finds all humans are 99.9% the same.

Although scientists have long recognised that, despite physical differences, all human populations are genetically similar, the new work concludes that populations from different parts of the world share even more genetic similarities than previously assumed.All humans are 99.9 per cent identical and, of that tiny 0.1 per cent difference, 94 per cent of the variation is among individuals from the same populations and only six per cent between individuals from different populations.Nonetheless, the team found that tiny differences in DNA can provide enough information to identify the geographic ancestry of individual men and women.

The results of the study, published today in the journal Science, have implications for understanding ancient human migrations and for resolving an ongoing debate about the use of family histories in medical research, said Prof Marcus Feldman of Stanford University who led the team.The team analysed DNA from 1,056 people from 52 populations in five major geographic regions of the world: Africa, Eurasia (Europe, the Middle East, Central and South Asia), East Asia, Oceania and the Americas.

To identify specific populations, the research team looked for 377 "microsatellites" - short segments of human DNA that occur in specific patterns, which are passed down from generation to generation. "Each microsatellite had between four and 32 distinct types," Prof Feldman said. "Most were found in people from several continents, suggesting that only a tiny fraction of genetic traits are distinctive to specific populations.

This means that visible differences between human groups - such as skin colour and skull shape - result from differences in a very small proportion of genetic traits." Using powerful statistical techniques that use many independent genes it was possible to pinpoint the ancestral continent of virtually every individual from Africa, East Asia, Oceania and the Americas. People from Eurasia - which includes Europe, the Middle East and Central/South Asia - were among the most difficult to assign ancestries, Prof Feldman noted, due to a "complex history of migrations, conquests and trade over the past few thousand years."


شاهد الفيديو: تقنية كريسبر وتعديل جينات البشر بشكل مخيف (يونيو 2022).


تعليقات:

  1. Narve

    برافو ، سيكون لها جملة رائعة بالمناسبة

  2. Matthew

    هل انت لست خبيرا؟

  3. Visar

    نعم أنا أفهمك. يوجد شيء في هذا وأعتقد أن هذه فكرة ممتازة جدًا. اتفق معك تماما.

  4. Lewis

    وأنا أعتبر أن كنت ارتكاب الخطأ. أقترح ذلك لمناقشة. اكتب لي في PM.

  5. Colquhoun

    great all

  6. Pepe

    يمكننا التحدث عن هذه القضية لفترة طويلة.

  7. Crom

    عن طيب خاطر أنا أقبل. موضوع مثير للاهتمام ، سأشارك.

  8. Kazrabei

    لنتحدث عن هذه القضية.

  9. Mikabei

    أعتذر عن التدخل ... أنا على دراية بهذا الموقف. يمكنك مناقشة.



اكتب رسالة